Homo_sapiens Locus Mono:309:AP001610.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:309:AP001610.1
Homo_sapiens
Mono:309:AP001610.1
21
SNORA32L3
1001..1121
2121
GAGGAGCCATCCCCGAGCAGACAGGGGTAAATTGGTGGTGAAATGATCACTGGGGTTCA
GACAAGTTAGATCTGATATGAATTCTGGATCCCCAAAGGGAGACACCAAGGAGGCAACTG
AATATCCGAGTCTGGAGTTGCAGAGAGGCCCGGGCTGGGGGCAGGAACACAGGAGTCTTT
CCCATGTGGGTATCAAGACAATCTTTAATGCCGTAATGCTGGCTGGGATCTCCCAGGAAA
TGAAGCTGGAGACAAGAGCCCCATGCAGTTCCCTGGGGCACAGCAGAAAGCTCTAAGGAG
GGACAGGAGGAAAACAAGGTGAAGGAGGTGCTTGGGCTAAATTGTGGCCCCCAAAATCCA
TATGTTGAAGTCCTAACCCCCGTACCTCAGAATGTGACCTTATTTGGAAACAGGGTCTTT
GTGGAGGTGATTGAGTTCGAATGACGGCATTAGGGTGGGCCTGGTCCGATCTGACTATGT
CCTGTAAGACGAGGAGATGAGGACACAGATGCACACAGAGGGATGACCCTGTGAGGACAC
AGGGAGGAGATGCCATCTGCAAGCCGAGGAGAGAGGATTCAGAGGAACCAGCCCTGCCAA
TAACTTCATCTTGGATTTTCAGCCTCCAGGACTTTGAACCAATAAATGTACGTTGAAGCT
CCCCACCTGTGGGATTTGTTATTGCCGCTCCATACAGGTGGGGGCCTGGGAACCTGGACT
CATACAGGTCGGGGCCTGGGAACTTGGGAAAATCGTGCATCGCAGAGTGGGGCCCAGGAG
GCCACTGCTGCTGGGGGTCAAGTGAGAGTAAGGCTGGGAATGTCCCTCCTTCCCCATGAG
CGTTCTGAATTGTTTTCTGATAATAACGGAACAGATATGTTTGGAAATAGTTTAAAATCT
GGTACTGTGACTGGTGCTTCACATATTTGTTTGTCTCAAAACACACAGATAGGTAATCTA
TATAAAGAGAAAACAAGAAGACACAGACTGGAAAACAGATCTGGTTGTTACCAAGGCATT
TAGCATGCAATTTCTCATTTGCTGTGGACACGACGAGAAGAGAATTCCTCACTCGGTTTT
CTGTCTGCCACCTTGCTAGCGATCAGCCCACTGGGAACATTTTATTAACCCCTTATTAAA
CTTTTATTAGTTTTACTTCCATTGCCTAGATAATCACTGTCCAATGAACACAATGCAAGC
TAGAAAAAAAAACAAACTACTGAAAATCCAGATGGACACCTTTTGTGGGGGCAGAAATGG
AACAGAAACGCTTAGCAGCAGCAGCGAGGGACATTGCAGCCACCAGCTGAAGAAGGGCTC
CTGCCCCAGGGGTCCGGCGTGGTTTGGGTCTAGGGGTCATGGGGCCAAGAGGGCATCCAG
AGAGACAAGGAGTCAGGGTCAGAATCAGACTCTGGGAGTGCAGGTTGAAATGAGACTGCT
GCAGACCTCCCTCCTGAAATGTTTGTAGCAAACTGGTCCCCAGCAGGCCTGGGGACAAGA
AGGTGTCTCAGCAGGATGGGAAAAACTGAGATGCTGGGCCAGGGACACTCCGCTGACTTC
TAGGCAGGGGTTGCAAATGTCACGGTGAGACCTGGTCCTGGACGGAGACCAGCAGGCAGG
AGGAGGCAGTCACGGAAATCCACAGAGAGAAAAGAAATTGCATAAGGAGATGGCACTCCT
CAAATGGGGTGGGGCACCACAACTCCAGAACAAATGCCAATGCAGGGCACAGATGAGAAA
AGCCATCATTAGAATATGCATCTTAGCTGGGTGTGGTGGCACGCACCTGTAGTCCCAGCT
ACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCAGGAGGCAGAGGTTGCAGTGAGCC
GAGATCGCGCCACTTCACTCCCGCCTGGCAACGAGTGAGACTCCATCTCAATAAATAAAT
AAGTAAATAATTGAGATGGGTTCTCACTATATTGCCTAGGCTGGATCCCAACCCCTTGGC
TCAAGGGATCCTCCTGCCTCAATACAAATACCAATTTTTGTATTTGTAGTAGAGACAGGG
TTTCACCATGTTGGCCAGGATGGTCTCCATCTCTTGACCTCGTGATCTGCCCACCTTGGC
CTCCCAAAGTGCTGGGATTACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved