Homo_sapiens Locus Mono:13:AC012560.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:13:AC012560.5
Homo_sapiens
Mono:13:AC012560.5
10
SNORA71CL1
1001..1117
2117
TGTTCTAGGTCCCAAACTCTGGAGTGCTGTGTGGTCTTGAACAAGCGCCCTTTTCTCTC
TGTGATCCCATTTTTCTATTTGTAAAATGTGGGGATTGGACAAATCCGTCAGTTTCCAAA
CTCTTATTTGTGGAACACTGGGGCTCACTGGCAGGGATGGGGAGAGGGAAGGGGGTAGGC
AGGGGTGAGACCCACCTCCTTTACTCCAACCACAGTGGCTTTTCTTTCATTGGTCCTACA
TTCAGCTTTCTAAGGAAGGTTATACATGAAGAGCAGTTTTCTGCTACCAGAAGCACTGGA
CCCCCACTGGGCTCCAAGATCCCTTAGAGTCTCTGGTGTTCGTATGATAAAAGTACTAGG
CTTGGAAAACCAGATTTTGCTACGTCCTTTAACAAGTGTCGCTTTATTGTGCTGAATTTG
ATCTCTCCAGAAAAATAGTGGCGTCTGTGCAGACAGGCAGTGCGACTTGAGGGAGTGTGA
GGACCCCACGGAGTCAGACACAGAGGGGCAAGAACAGCTCTTGCAAAGCAGAGACCAGGG
GCCAACTGCCCACAGCCGGCCTCCTCAGGCCCAGTGGGGCTCCAAGTCTTCGGGAATGCC
CCAGGCAGTGGGTGGCTGTCCTCTCTGTGTTGAAACAACAGAGCTGTTTTCTTCTGGGTC
CCCCGCCCCCCTTGGCTGTCAGCTCTGAGCAGGGTGTGCAGCCCCCTGGCTCCTATCCAC
ATGGAGCCTGGTCATCTCCTTCTGGGGTCTATCAACTGCATGAGCTGTCAGTGGAGGCCA
CGGCGGCCTCTCCGTTGCTGACCTCTTGTTCCCCAGCCTCTTGAAAACTCGCTGCAATTT
GTCTCTGATCCTGCTGCAGTCTCCCCGCCTTCCCCTGAGGTCGGGGCCTCAGGCTCTCAA
GACTGTAAGGCTCACTGTCTCCGCTGCTGCCTCATTTGCCAGGCACTTCAAGCTCCAAGT
CTCCCCTCCTTCCTCACTTTTAGGTCTTTGAAATTTTGCGCCCCTATATTCGAAAGTTAT
CCTGGTCATTGACAGTGCAGGGAGAGAAACTGCTGAAAGCATTCCCCCTTGTTTGGAGGG
TCCACTCCTGTCCCTTCTAAACTCTGGAGTTTTCCACACCTCCTCTTTTCTGTCACCTTT
TAGATGCCTCCTGATACCTGGTGTCTCGCTTATGGTGTGCTCCCTGTGTGAAGCTCAGTG
CTGGTGTCTGTGAGGCTTTAACCAAGGTATACATTGAAAAAAAAGAAGAAGAAGAAGAAA
TAAAAGAAACTTTTTTCTGTCTGACTTTCTGTGTGTGTCAGCCCAGGCCTGGGGAAGTGT
GAGGGCAGGCTGGGTGAGTTTGCCAATCTTGTCATCCCAGAACCCCAGAAACATCACTAC
CCTAGTGCTCCCTGCACACCCAAGCCATGCTGGCCAGATGTGTCGCTCTGGTCTCTGTTC
GACTCCAGCCCAGCCTATTCTCCTTGGCAGCAGCTCCTGGCATGCTCTGCAGAAGGGGCA
GCTATTTCAAACCAGGCTGAGGGCCCTGGATGTGGCCATTTAAAGAAAAGATGATGGTAG
CTGTCTTGCCAGGCAGCACCACTGTGGTCTCACAGAGCACCTGGCAGCCTGCTTCAGAGT
ACACACATTGCCTGCAAAGAGTGCTGGTTTTCTGTTCCTTCTCAAAACTTTGCCTTGGGA
CAGTGGCTGGGTCGGAGGCTAAGGCCGTCTTGGGGCATCCTTTGCCCAAGTGCAGTTCTT
CCCACTGAGCCACAGTGTAACCTCTGACAGAGTCTGCCCAGGCTGGGGCTGGCGGGTCAC
CTATTTATTTTAATAGGGCAATCTCTTTTGGGATGACTGTAAGCAGAGGCCCCAAGTGAA
AGACATTTGAAAACAAGCTGCCTGGAAACAAGCCTCTTGGAGGACCACAGGGGGGTGGAT
TCTGGAGTCTTCTCTTAACGTGCATCCATGCCTCCCCTGCCTCCATTCATGTTGGCCTAG
TCCATGGCCCTCCCCTCCTACTTGAGGAGAACAGCCTTCCAGACTCCTGGAGGCCCAGGC
ATGGGACGTGCCACAGGTGGACCTAGAACCCAGGTCTCTGAGTCTCAGTCCACTTCTCAT
CACTCCTGCTGAACCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved