Homo_sapiens Locus Mono:209:AC003014.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:209:AC003014.1
Homo_sapiens
Mono:209:AC003014.1
X
SNORD3L5
1001..1213
2213
CCCAAAAGGTTAGCTTATTTTTCAGGTTTCTTTTGCTTTTACCTAAAAAAGTTTAGTAC
CACCAAATAACATTTAAGAAATTCAGAAACTGGATGAATTGCAGTAGAGCTTGATGAAAG
TTTCTGAGAGAATCTAAAAGCTAATTACTAAATTCCAGCTGCCTGATAAACTCTCAACAT
AAGTAGAATTGGCAACTTCCTGTCAAGAATTTTGTGAATGTGAGAACACTCCCCTTACAA
ACAAGTACCAGACTCTTCTACATCTACAGCAGGACAATTCTTACCACGAGAGTACTTTTG
GCTTTAACATGGAAATTCTGAACTGAATAATTCAGGGGTGGCATTAACTGCCTATCCTCT
TCTGTGGCAGGCTATTTATTTAGAAGCTCTACTTATTATTAAGCTCTACTTATTATTGGA
GAAGCTCTACTCCATAACTTTCTGGGAGAACCAAAGGACCAATTCTCTTTAGCCACTAGT
AACCACCCCCGCCCCCCCCCCGCCCCACTTTTAGATATACAAGATTCTCAGGTGATTTCT
AAGAATCAGGGAAACAAAGAATACCTTTTACACGGCTCTGTACTCTACAGAAATGACTAA
AAAATACTAATCTACAGATTCTTGAATGCAGTGACACCTAAGTATGGTACACAAATTATA
TATAAAAATAAATCTACACTAGGACAAGTGACAGTGAAACTGCAGAACATCAAAGGCAAA
GAGATTTTATAAATAGTCACAGTTAAAATAATAGTTGACTTCTCAAGAGCTACAATGGAA
GTCAGAAGACAGTAGGATCATAGTTTTCAAAGCACTGAATGGAAATAACTGCCAACCTAG
AATTCCATACTCATTGAAATATGCCCATTTTCTGATGATTAGTTTGAAATAGTGACATTT
TCAGATAACCAATAGACCCTCACTAAAGGAAATTCTAAAGGATGGAGTTTAGGCTAAAGG
AAAGTGATCCAGGTACAATAATAATCATATAAGAAATTGTGAAGACTATTTTCAAGGTTC
ATTTCTATAGTTCACTACTGGAGAAGTTTCTCTGAACATGTGGAACACCAGGAAACATGA
GGAAGAAGCACAGCATTCTCTCCTAAATGTGAAGCCAGCTGTTGGTGTTGCTTTGCTATA
ACTGCTATTTGCCATTGATGATTATTTTCCTCTTCTTCCCAGAGAGTAAGAGGGAGAGGA
TGCAGTCTGTGTGGTTCCCATTAAAAAGAAAGAAAAAGAAAGGAAGGAAGGAAGGAAGAA
AGAAAAAATTTTTGGATAGAATAACAAAGCGATAACAAAGAAAGATAAATAAAAAAAAGA
ATTGCTCTTCTTTGTGAAAATGTGATGCTCTCTGAGTTAAAACGTTACCTCTAAAGTCTC
TGTAAAATGCAAACATGCTATAAAAAAGGGATGACGTATGACGTCATTAACATTTCTGAT
ATAGTGTGTATTCTAATATAGAAAGTGTGTTCTCGACCAGGCGCGGTGGCTCACTCCTGT
AATCCCAGCACATTGGGAGGCCGAGGCAGGTGGATCACCTGAGGTCAGGAGTTCGAGACC
AACCTGGCCAACTTGGCAAAACCCCGTCTCTACTAAAAATACAAAAAAAAAATTAGCTGG
GCATGGTGGCGGGCACCTGTAATCCTAGCTACTTGGGAGGCTGAGGCAGGAGAATAGCTT
GAACCGGGGAGGCAGAGGTTGCAGTGAACCAAGATCCCTCCAGTGCACTCCAGCATGGGC
AACAAGAGTTAAACTCCGTCTCAAACAAACAAATAGAAAACGTGTTCTCTGTAAGATTAC
TGCTCCAAGTGCCTTGAAAATAAGGTTCAAATAAGTGTGGGAAATGTGGTGTTAAACAAA
GGGAAACCAGATTCTTAACTGTTGGACTTCGTAGCATCTTTAAGTATGCTAATGTACATT
TTGAGTTTCCAAGAGAGTGATAGAGTATATATTTCCCAATTTTATTTAACCGCAGATTTT
ATTTTTTTCAAAACAATTTAATAGATTGGCATTCCTATAGATCACATTTAAAGCCCCTCT
GTCCCTAGCATGGTCCCTGAAATTCTTCATCAAATTAGATGATATTCCTGGAACATGGAG
GCATGGGATGGGTAAATCCTTACAGAAACATGAGAAAACAACAAGATTAAGAGTATAAAG
TGGCTCATGGGATGGAAGATCCAGATTGGGGAGCTCCCTTGTGAGAATGAGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved