Homo_sapiens Locus Mono:251:AC126172.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:251:AC126172.8
Homo_sapiens
Mono:251:AC126172.8
12
SNORD74L4
1001..1080
2080
TGCCTGGAATGTCATATTTGAAAACTATGTTTATTTACTCGTATATCACCAAGTCCTTT
TAAGTAACTAAAGTTGTTTTATGGAGTCAAGGCTTACAAAACCATTGGGTGCAGTGGTGC
ACACCTGTTGTCCCAGCTACTTGGGAGACTGAGGCAAGAGAATTGCTTCAGCCCAGGAGT
TCAAGACCAACCTAGGCAACATAGTGAGACCCCATAGTGAGACCCTGTCTTTAAAAAATA
AACAAATAAAAAATAAAACGCTTATACAACCCTCTTGAAAAAACTGGCCTGGGACCTGGT
TTACAGGGTTTCCAGACTTACTCTTTTTTCATTGAGTTTTTGAGTTTCACGAAGGCATCA
CAATATATCTTTTTAAAAACAACCCATAATTGGAAACTTAACTAATCAAAATGGGCCACC
TCTCCTCATTCATACAAATGAATGGAAGAGATTGGAGCCCACACAGCTGCCAGGCTCTAT
GCAGGGCACTTGGCACATAATCTACAGGATGTTTAAATTTTTATTTTACTTTATTCTTAT
TTTATTTTACTCTTATTTATTTATTTTATTTTATTCTTTTTTTTTTCTTTTTTAGAGTTT
TTTTGAAAGTCCTTGTCAGACAGGTAATGTGTCAACATCATAACGAGGTTTAAGGGAGGT
ACAGCTCACACATGAGCATGAAAACCCAATTATCATGCTTATGAACTACAAAAGGATCAC
AGGATATTTTTGTAAGTGCCTACCCAACAGATCTCCCCTCCTTCTGTGGTACAATGTGTC
CAGTGTTGAACTAGTAGCATTCACATTTCCCCACAAGTGTCACGAAAGGGGGACTGTCTC
CCAAGTTTCCCCAGCAGTAAAACCCGATTGGTTTAAGGTCTGCAGGGCGGATCTAGTCCT
CTTGCCAGTGATTAATTAGACATGACTGTATAACATGGCTGGGAGGTGGGAGCAGAAGAT
GAGATTCCAAAAGGAAAGGGTTTATGCTCTTGAAAAGAGCTATGTGATGCCTCTGATGAA
GCCTATGTTAGTAGAGACATCTGAGAGTGTAGATGAATGCCAATGGCCCTCATGGAAAGA
GAGAGAGATGAGAAAAAGCACACTCTTTTTTTGCATCTACATGTGATGTCTGGAATTACA
GCAGCCATTTTGTGATCATGAGAGCAGCTGGCTTGGCTAAGGACAAAATTCGTCACACCA
AACATGGCAGAGAAGAAAGAAGATTCTGGATTCCTGATAATATTTTTGAGCCACTGGACT
AACCAAGACTGGAATTGGTCTTCCTTGGGACTTCTTAATATGTGGGATAGTGAATTTTCA
CATTGAAGTAAATTTTGAATGGAGTTTTCTGTTTCTTATAGCCAAAACCATCTTACCTGC
TACAAATATTTTATTTAATTTCATCTTTACAACAGTCCTATATCTGTGGACATTCTCATT
TTATAGATAAAAATCTGAGATTCAGAAAGTTTTAGTAACATGGCCAGGCACAGTGGCTCA
CAACTGTAATTCCAGCACTCTGGGAGGCCAAGGTGGGGGGACTGCTTAAGCCCAGGAGTT
TGAGACCAGCCTAGGAAACATATTGACACTCTGTCTCTACCAAAAAAAAAAAAAAAAAAA
TTACCTGGGCATGATGGTACATGCCTATAGTCCAGCTACTCAGGAGGCTGAGGTGGGAGG
ATTGCTTGAGCCCAGGAGGTCAAGGTAGTAGTGAGCTGTGATCGTGCCACTGCACTCCAG
CCTATGAAACAGAGCAAGACCCTGTCTCAATAATAATAATAATGACAGATAGAACAACCA
CACAGAAGATAAGTAAGGAGAGAGAGGACTTAAACAACATAATAAACCAACTAGAGCTAA
CGGACATATACAGAACACTCTACACAACAGCATATACATTCTTCTGAAGCACATGAGACA
TTTTCCAGAATAGACTATACGTTAGGCCACAAATTAAGTCTCAATACATTTTAAAAGATA
GATATTATAGGCCTGGCACAGTGGCTCATGCCTGTAATCCCAGCACCTTGGGATGCCAAG
GTGGGTGGATCACCTGAGGTTGGGAGTTCAAGACCAGCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved