Homo_sapiens Locus Mono:141:AL160271.19
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:141:AL160271.19
Homo_sapiens
Mono:141:AL160271.19
9
SNORA67L1
1001..1137
2137
CGGCCCAAAAGTTCCTTCAGCTGATACACAACTTCAGCACAGTTTCAGGATACAAAGTC
AATGTACAAAAATCACTAGCATTCCTCTATACAAGCGATAGCCAAGCCAAGAGCCAAATC
AGGAAGGCAATCCCATTCACAATCGCCACAGAAAGAATAAAATACTTAGGAATACAGCTA
ACCTGGGAGGTAAAAGATCTCTACAATGAGAATTACAAAACACTGCTCCAAGAAATCAGA
GAAGACACAAACAAATGGGAAAACATCCTATGCTCCTGGATAGGAAATAAATATCATTAA
AATGGTCATACTGCCCAAAGCAATTTACAGATTCAATGCTATTCCTATCAAACTACCAAT
GACAGTATTCACAGAACTAGAAAAAAAACTACTTTAAAATTCATATGGAAGGAAAAAAGA
GCCTGAACAGCCAAGGAAATCCTAAGCAAAAAGAGCAAAGCTGGAGACATCATATTACCC
AACTTCAAAGTATACTACAGGGCTACACTAACCAAAACAGCATGGTACCAGTACAAAATC
AGGCACATAGACCAATGGAGCAGAATAGAGAGCCCAGAAATAAGGCTGTACACTTAGGAC
CATCTGATCTTTGACAAAGCTGACAAAAACAAGCAATGGGGAAAAGACTCCCTATTCAAT
AAATGGTGCTTGGATAACTGGGTAGCCATATGCAGAAGATTGAAACTGGACCCCTTCCTC
ACACCATACACAAAAATCAAATCAAGATGGAATAACCACTTAAATGTAAAACCCAAAACT
ATACAAACCCTGGAAGACAATCCAGGCAATACCATCCTGGACATAGGAATGGGCAAATAT
TTCATGGCAAAGACACCAAAAGCAATCGCCACAAAAGCAAAAATTGGCAAGTAGGATCTA
ATTAAGCTTAAGAGCTTCTGCACAACAAAACAAACTAACAACAGAGTAAACAGGCAACCC
ACAGAATGGGAAAACCTATTTGCAAACTATGTATCTGACAAAGGTCTGATATCCAACATC
TATAAGGAACTTAAACAAATTTACAAGGGAAAAGCAACCCCATTAAAAAGTGGGCAAAGT
AAGGTCTTTGGGGAACAGGGATGCTTATTTCCTCTGCCTTCCTTGTCTGCCTACACGGAT
ACCTACGTCTCTTCCCTTTGAGATACATCTCACGCACATGCTGAAGAGTTGTCTTTCTTG
ACATAGGCCAGAGGCATTGATGTGCAGCAGGTTTCTTTAGTCAACCATGACCTTCCCACC
AACAGGGAAAACTATATCCACAGAATCAGTCGAGATGGATGGTTTGGCCGTAAGGGTGTG
GCTATTAACATGGTGACAGAAGAAGACAAGGGGACTTTTCAAAACATCGAGAACTTCTAC
AACACTTCCATTGAGGAAATTCCCCTCAATGTTCCTGACCTCATCTGAGGGGCTGTCCTG
CTCCCTAGCCCCAGCCAGGGTTCAATCTTGGAGGGCTGAGGAGCAGCAGGAGAGGGGAAG
GAAAGGAGCCAAGGGATGGACGTCTTGTCATTTTTTTTCTTTGAATAAATATCATTTTTT
GAGGCAAAAGAAAAAAAAGTAGGCAAAGGACATGAACAGACACTTTCCAAAAGAAGACAT
ACATGCAGCCAACAAGCATATGAAAAAAAGACTCAGTATCACTGATCATTAGAAAAATGC
AAGTCAAAACCACCGTGAGATACCATCTCACACCAATCAGAATGGCTGTGATTAAAAAGT
CAAAAAATAACAGATGCTGGTGAGGTTGTGGAGAAAAGGGAATCTTTATACACTGTTGGT
GTTAATTAGTTCAACCCTTGTGGAAAACAGTGTGGCAATTCCTCAAAGAGCTAAAAACAG
AACTACCATTCAACCCAGCCATCCTACTACTGGATATATACCCAAAGGAATATAAGTCAT
TCTACCATAAAGACATGTGCGTGCAAACGTTCATTTCAGCACTCTTCACAATAGCAAAGA
CATGGAACCAACTCGAATGCTTATCAATGACAAATTGGATCAAGAAAATGTGGTACCTGG
TCGGGCATTGTGGCTCACACCTGTAATCCCAGCACTTTAGGAGGCTGAGGCGGGCAGATC
ACTTGAGGCCAGGAGTTCGAGACTAGCCTGGCCAACAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved