Homo_sapiens Locus Mono:159:AL138691.15
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:159:AL138691.15
Homo_sapiens
Mono:159:AL138691.15
13
SNORD44L1
1001..1061
2061
CACTCTCTCCATCACCCCTTGAGCCAGGGAATCCATGTGAGTGGGTCTGCCAAGAAGAC
CAAGTGAAAAAAATGAGAGTCTTCCAGTGATGTTTTGAGTGCCAGGTCCAGGTGCTTTTA
CATTCATGACATCGTTCAGTTGTCACAATAATCCTACCATGTAGGATTTAATATCTCCAC
TTTATGGATTAGAAAATTGAGGATTAGAGAAGTCACCAACCAGTGCTCCAGGCAACTGCA
GGTCACGAAGCTGTGACTTGCCTCCAAAGACTGCTGACTAAAGGCTGGAAAGTCTGGCTT
AACCTACTCGTGTGCATATCACCTATGAATTAGCATAGTCAATAAATACTAGAAATGTTA
CAGTTGTTTTAACTTTTCAAATGAAATTTGTTTTTATTGTGAATTAATGACTGAGAAGGC
CCTTTCTTCCTATATAACATGGGTTATTTTTATTTTTATAGCATCTAATATTATTACAAT
ATTATACACACACGTATCAGCAGACTCTTCCTCTTTTGAATGACAATTACTCAAACTCAC
CCCATTGACAATATCTAACTCTTCGGTGAAGTCTTTCAATAATTGCAGCTGTGCTTCTAT
ATTCAAGGACTGGAATAAAGTGAAATATTGACCCTGGTCAGCTCCGATTCAGAGAAGATT
TTGATATACCAATTGTATTCCTATTCAACAATTTGTACATTCCATTCTAATTGCATCTGG
CTTACTACAGAGGTTGAGTGTTGAGAAAAAAGAATGGGGCAGGAGAACATGAGAGGGAAG
CTTGTGTTCAGTTAAACATAAGTACAGAAATTCAACAAACCTGTGAAATTCATTATTTTA
TGGCTCATCAGTTGGTTCAGCTTAAGTCCTTGGATAAACTGCATAGAAAAATATTACCGC
TTTAGTGAAATTACTGCTTCTAATAAAGAATGGGTAAGCAGAATCTCAAGTTATATAATT
TTTTTTGATGAAGTCAATTCCAACAACGTGAAAGCCACTGCCCTGGGTGATGATAAGCAA
ATGATGCCTGAATGTGAAGGTCATACTCGGCTTTAGCTGATTTCAAACAAATAAACAAAA
ACAAAAAACAAAAACCCTCCACCACAAATGATGATTTCGGAAAGTTATCTCACCCCTGGA
ATCACCTGTGATGAGAGCATGATCCTTCTAGCTGCATCCTCTTCATCCTTCAAGCTCCCG
CACCATGAGGCCCGACCCTCCCGGGGTTGCACAGCTGCACCCCACAATTCCACACTGAAA
TCTCGGGGTCCCTCCGCCACATCCGCACAGCACATCTGCCCTGAGCAATTGTTCCCTGCC
CCTCCCTCAAAAGACCTAGGCCCAGTTCCACCTCACAGCTGAAATAAGACATCCAGTGCA
CTGCACGAGCCCGGGCAGGGATGCTTGCTGGAGTTGACATCTGTTCCAGTCAACCCCCAC
CTTCCTGAACGGCACATGCACCTCGGTAGGAGACGAAGCAAAATTCTGTGGTTAGATACT
TTTACGTGGGAAAATAGTGAACTTTAGCCGGAAGGTGAAAATACATTCTTTTCTGTACAT
TTAGAATTAATGAATCCTATAGACCTGTGGAAACTGCTTTTAAACATCTGATTTTCCATT
AAGATATAATTAAAATTAATGGCACAGAGAAGCTTTAGTTCTCTGGAGCCCCCCCCCCCC
CGGCAGGAGAATATTTGTTCTGTATATTTTTAAGAGGGTTTGGGGGGCATTAAATTATGC
TTTGATTGTATTCCATCAATGAGAATATAAGACACACACATTATTATAAGAAACAAATAA
GCACTTATTAACTGTGTGTGCATTCATGGGACACAGAAATGGTCTCAGGCTGAGCTTATA
GTGAAGCAAATTAAAATTAGTGTTTTGACTTTTGTTCATTATAAAGTAAATACTAGCCTA
AAGATTCCTAATCAGTTGCCAAATACCTATCATGAAGGAATATGCATTGCCGAATGAAAT
CGCTGTCCTCAAGAGAAAGCTCTGAGAATTCTTTTAATCTACATAAGGACAAATTTGCCT
TTCATCACATTTTGTAGTAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved