Homo_sapiens Locus Mono:168:AC092040.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:168:AC092040.2
Homo_sapiens
Mono:168:AC092040.2
3
SNORD3@L10
1001..1212
2212
CACATAACTGAATTGAGGATAAAGGAGCAGACACCTCACATTCATCACCCAGCATAGAA
CAGCTGAACTAGGAAGGCCTAGAAAGTTCATTCTGTATAAGAATAAAGGAGGAAAAAAAG
GGAGGGGTGATTTTAGGTATTGATAAGTGGTTAGTTGTGCAGGATCTGATATAATCCTAC
ATTCATAAGTTTTTGTGCTGGGTTTGGGGAGAGAGGGTGTCTCCCCAGACCCAGCACAAA
AACTTATGAATCTAGGATTATATCAGATCCTGCACAACCGGGGATTTACATCCTCAGTTT
AACTGAGTCTCATATACCCTTCACCTGTTTAAGTACCATAGCACCAAACAAACATACTAA
CTTATTTTAGAGATTCAGGCAATAGATATTCATTGAGCACCTCTAATTTGTCAGGTACTA
GATTGCATGCCAAGCATACCAAACGGTGCATCTGTCTTTACCCTAGATGGAGTCTAGTGA
GGAAGACTGGCCATCAGAAGTGATCACACACATCAATACAGTGTCCTGAACTGTGGGGAG
GTTGTGAGTGAGAATGTAGAGCCCAAGAAGAATGGGTGGAGGAGGTGCTCTGAATGAAAT
GGTGAGGAAGGGCCTCTCTGAGGATATGACATTTCAGTTGACACCTGGCAGCATTTCAGC
TAACACTTGGCAGTGTCATTCAGCTGGGGGCAGAGAGTTCAAGACAGAGGGAACAGCCTG
TGCGAAGGACAAAAAGAACTTGACACATTCAAAGAATTGAAGTAATGCCAGTGTAGGCGA
AGCCAAGAATGAGAGCAAGAGAGATGGGACTTGGAGGAAGAAGGAGGTTGACAGCACTGC
TAAGTTGCACAGGCATTCTAGTTCTTACTAAAATTTGTAGCCTTGTCCTAAGGACAATAA
GAGCCATTAAAGATGTTTAAATTGGGAAACACAGCATAATGTATTTAGAAACAATGGTTG
TTTGGAGAATGAATTGTAGGGGACAACAGTAAAAGCAGGGAAAGATTATACTTTCAGGAA
TCATTTCTATAGTTTGTTACTAGAGAAAGTTCTCTGAATGTGTAAAGCATGAAAAACCAC
AAGGAGACACAGTGTCTGCTCCTGACTGAAAAGCCAGCTCTTGGTGTTGCTCTGCTGCAA
CTGCTATTTGCCATTGATAACCATTCTTCTCTTCCTCTGGGATAGTAAGAGGGAGAGACT
GCAGTCTGAGTGGTTCCCATATTTGTAAAAAAACAAAAACAGGAAAACAAGTCATGGAAG
AGAATGCTAATTGCCCACCTAATAATCTTTTTCCCCTTTACACAGATGTCTGATTTTACT
TCAGTTAATGATGTGATTATATATCCCAAACTCCCTTGCAGCAATTACTGAACAATGACA
TATAAATAAGTGAAGTTCTTGGGTACAGCTTCTGAAAGCCATCTGAGAGGGACTGCCTCA
TCTGGAAGGAGGCCCTTTTGCACTTCACCTCCTTCCCCTAACCTGCTCCTTGGAGTGCAG
ATGTGATGGCTGGAGCTCTAGCAGCTGTCTTGTCTCATGCCACAATCAGAAGGTATTATG
ATGGCTTGGACCACAGAGGTGGCAGATGGGATGGAATGATGGAGTAGGAAGTGGAGGGCA
TGTTTAGAAAGGGTTTTAGTAAGAGGTTGTGCTTATATTGCATTTTGAAGGACCGGAATG
ATTTGATCAAGTAAATAAACATTGGGGTCCAGTGTGGTAGCTCACGCCTGTAATCCCAGC
CCTTCGGGAAGCTGAGGCGGGTGGATGATGAGGTCAGGAGTTCAAGACCAGCCTGGCCAA
GATAATGAAACCCCCATCTCTACTAAAAATTCAAAAATTAGCCAGGCATGACAGTGGACG
CCTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGAGAATTTCTTGAACCCAGGAGGTAGA
GTTTGCAGTGAGCTGAGATCACACCACTGCACTCCAGCCTGGTCAACAGAGCAAGACTCT
GTCTCAAAAAAAACAAAAACAAAAAAAAACAGAAAAAAAACCCACACATTGGAACAACTA
TTAATAGTTCTTGCTGTTTTTATATATTTCTCTAGTTTTGTTTTTATTTCAACATATATG
ATAAATAAAACCAGATGTTGAAAACTGTAGCTCACAGTCATATCCAGCCCTGTCACATAC
TTCATTTGGACACAGGGGTTGGTTCTAAATTTTTTGAAATCCTTAAAATTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved