Homo_sapiens Locus Mono:282:AC019176.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:282:AC019176.4
Homo_sapiens
Mono:282:AC019176.4
8
SNORA70CL2
1001..1134
2134
GTGGACAGATGGAGCATTTTTGCAGCTAACTCAACAAACAAACACCCATAACACATGCA
TGCACACACACCAACACACACTATATCTTGATATTCAGTCAAAATTATTTCTTTCTTGAC
TTTAAATACTATGATAATTATCTTTACTGCCTACTTACCTATAAACACTAAGCCAGAAGC
CAGAGTTTGAGATCTATCACTGTGATAGAAGTAGGAAAAAGAAAAAGCATTTGACAAAAT
TTAACACCCTTTCATGATAAAAACTCTCAACAGAATAAGTATAGAGGGATTTTAACTCAA
CACAATAAAAGCCATAAATGACAAAGCGGTAGCTAACATCATACTCAATGGTGACATGTT
GACAGCTTTTCTCTGGGTTCAGGGAGAAGACAAGGATGCCCACTTTCAGTACTTTTCTAC
AGAGCTGTGGAAGTCTGAGCTGGAGCAATTAGACAAGAGAAATAAATAAAAGTCACCCTA
ATAGGAAGGGAAAAAGTGAAATTGTCTGTTGGCTGACAATATGATCTTATACAGAGAAAA
CTGTAACGACTCCACTAAAAGCTAATAGAATTGATAAATAAATCCAGTAAAGTCACAGGA
TACAAAATCAACACACAGAATTGGTAGCATTTTTATACACTAATAAAAAGCTATCTGGAA
AAGGTATAAAGAAAAGAATCCTATTTACAACAGCAACAACAAATTAAATACTTAGGTATA
AATTTAAAGTGGTAAAAGACTTGTATACAGAAAACTGTAAAACTCATGAAAATTTTTTTA
AAAATCACACAAATAAATGGAAAGGTATGCTGTGCTTATTGCTTAATAGAATTAACATTG
TTAAAATGTCCATACTATCCAAAGTGATCTACAGATTCAATGCAGCCACTATTTAAATTC
TAATGTTATTTTTCACAGAAATGAAAAAAAAATTCTTAAATTTGCATGAGACCACAAAAG
ACCCCAAATAGCCACAATCTTAAGTAAAAAGAACAAAGCTGCTGCAGCCAGTTAAGCCAC
CTGAGTTCCTTTCCTCATAGGGGTCCAATGTGCAATGGCTGCAAACAGCCGCTTCCCTGT
AGTATATGCTGCCCATTTCTTGTATGGGTTGCTCTAAGGGACCTTGGAGACAGGCTTTCA
GATGGATGTTCTTGCCTCTGAACTTGCACTACCCCAATGCAGGCTCCAAACAGACATGTG
AGGTGCCTTGGAAAAGGCCCAGGGCACTGTGGACAGGGTTCACATTGGCCAAGTTATCAT
GGCCATTTGCACCAAGCTGCAGAACAAGGAGCATGTAATTGAGGCCTTACGCAGGGCCAA
GTTCAAGTTCCCTGGCTACCAGAAGATCCATGTCTCGAAGAAGTGGGGCTTCACCAAGTT
CAACGTGGATGAATTTGAAGACATGGTGGTTGAGGAGTGGCTCATCCCAGATGACTATGG
GGTCAAGTACATCCCCAGTCATGGCCCTCTGGACAAGTGGTGGGCCCTGTATTCATAAGG
GCTTCCACTGTGCTGCCCCCTCTTAACACTCACCCACAAATTCTACCTCCTGTCAAAAAA
AAAAAAAAAGAAGCGTCAGACTATCTGACTTCAAGATATATTACAAAGCACTTATAATCA
AAACAGCATGGTACTCACATAACAACATATTGACCAAAGGAACAGGACAGAAAGCCCAGA
AATAAACCCATGCATTTATAAGCAATTGAGTTTTGACAAATGTGCCAAGAACATACAACT
TTGAAAGGACAACCTCTTCAATAAATGGTGTTGGGAAAACTGTTCATCTCATGAAGACTT
CTATGAGGATTGTGTTTTCATGAGAACAGAAGAGGTTAAAACAAATAAAATGATAAAAGA
GAATGAGGCATATTGAAATGTCTTCATTGCCTAGGGTAATACCTGAGATTCATTCCCTCA
TAGCCACGGAAAACTGTGACTCAGACCACCAGAGTGAGGTTAGGAGCAGAAGTTTAATAG
GTGAAAGAAAGAGAAGAGCTCTCTGTACAGAGAGGGGTCCCAGAGAAAATGAGTTGCTGC
TTCCACGATGAAGTACAGGAGGTTTTATAGATGAGCTTGAGGAGGTGGTGTTTAATTTAC
ACAGGGCATGAGATATCGGTCAGCCCAGGTGTGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved