Homo_sapiens Locus Mono:110:AC053527.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:110:AC053527.8
Homo_sapiens
Mono:110:AC053527.8
4
SNORA45
1001..1125
2125
TGAGCCTGTTCCAGTAACTGGTTAAAACTTTAGATTGTCTCCTTTGGGACAGGGTATGT
TCTGTGTGTGGAAAGACAGGTAAAATACATGTTTAGTGATCAGAATAGTAGATTCTTGCA
AATGCTAAATTCTTCTGGCCACACAGCTATATTTCCATGCCTCTCTTGCAATTAGGTATA
TGGGTTAGGTGTGCTGATTAGGTTCTAACCAGTGGAATGTGAGAAGTGATGCACTCCTAT
TCCAGCTCTGGCCTATGGAAACATCACATGAGCAATCCAATATATCCCACTCCCCATCAA
CTTGAGGCAGATGAGCAAATTTGCACTGGAAACTATGTGTTAAAGATGGCAAAGCCGCAA
GATAGGACTCCTGGTTTCCTGAATCTTCACTTGGAGGATACTTGCTTCCCAATTAGAGAC
ACTTGTGCTAGAGTTTCCTGACTCTTCACTGGGAGGATACTTGCTTGCCAATTAGGGACA
CTTGTGCTACAGCTCATACGCATTCTTTTGTGTTAGGCCACTGAGATTTCAGAGCGTGCC
CTAATAAAGACCTGTCCCTCTTTCTCCAGATGCAATCGTTCATTACCTAATTCTAATTTT
TATACCACAGGAGTAGGCCCACAAATCAGGCTAGCCAAAGTATCCTATCATTCAGCCATA
GTGATTAGTTCAGGAATGGGCAGATTAACAAAACTGAAGTTAATCAGAGATAGTCTTATC
ATTTGGGCTAGCACTATCAAGAAAAAGACACCTGCTTCTGGAATAAGCAAAAAAAAAAAA
AAAAAAAAACACAAGCTACATCTGGCCTTTGGTCATCATGTCGAGTGAACCTGCCTAAGA
ATGAAATCTTACAGGGAAACAGAGGCAGTCTCAATGATACTGCAGAAGGGGAAGATATCC
CATGAATTGAGAAATATTTCCTGGGTTTCTACTCGATTGAAATTCCAAGAGGTAAGGGAT
AGATACTGCCAGGAAGACTTGGGAATTCAAAAGAGGAGCTCTCTGAGACTAGAGTCACAT
CCTGACACGGCTCTTCTCCAATGTGCTGGAGTCCTCAGCATCTGCTGGTCTTGATTCACT
GATGGGGGCAACCAGTGTCCCCTTAAGTGTCCGGGCAGAAACATACTGTACCTTGGTTTT
AGAAAGTAGGTTGGCAGGCATCTTTCCTCATTCCCATCAAGGAGTTGGTACCTTCCACAG
TGTAAGTTATTTTCTCTGTTCTAGAGCTACTACAAAGTGCTAGGGAAGGAAAATCTCCTA
AAGCAGTCTGTCATCATGAAGGCCAAATTATGTAGCAGAAGAGCTTGGAAAAAGATTAAG
ACGGTGGTGGGGAGGACCTTTGTCCTGGTGGCTTGAAGCCATAGGGAAAGAGGTTCACTA
AATGCCAACAAATGCTAAAAAATAAAAAAATAGACAAAACAGCGAGCCAGTGGCTTGTGC
TCTGCTTTCCACCTGAAAGTTTGCCCAACATAAGCAATTATAATCAAGTAGAAATTGAAG
CATATGTTTAAGCAGAGAGGACCAGGTAACATTGATAACCACTGTCCTCCCAGCCACTGC
CTTAATTAGGCTTTCATGAGTTTTCACCCACATTATTGCAATAGTCAATCTCCCTGCCTC
TGATCCTATTATACTCTACTTTATCCTCCACATTGACACCTGAGTTACTTCTCTACCTTG
TAAAAACAATTTATTTCTGAGTACAAAAACACTACATGTTCATTGTAAAATACTAAGAAA
ATACAAAAAAGCACACATACCAGAACATGCAATTCTATCATCTAGAGATATCCACTGTTG
ACATTTTAGTACAAACCTTTACACAGTTGTTTTCTCTGTGTATTTTTAAATGAGAATGCC
ACTGTTGTATTTAGCATGCTTTTTAAAATTTTTTATTTATTTTTATTTTTCAATCCACCA
GTAAGATATCCCGGAGCATGCTTTTTTTTTTTTTTAAACTTAGTATATGTGAGCATTTTC
TCATGGAATTAAATGCCCTCTACAATATTATATATAATTAATATATCAATTTACTTAAGA
CAGGTGTTGCAAACTGGCAGCCTATAGCCAAATGTGATATATGAACATGCTATATACTTT
GTCATTACAGCATTTCAGAGTTGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved