Homo_sapiens Locus Mono:98:Z84480.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:98:Z84480.1
Homo_sapiens
Mono:98:Z84480.1
6
SNORA40L11
1001..1128
2128
TTTCTTAGGGAAACTTCCATTTTGCTCTTAGGCTATTTAACTGATTGAATAAGGTCCAC
CCAGATAATTAATGGATGATAATCTCCTTTACTTAAAGTCAACTGTAGATGCTTATCCTA
TCTACAAAATTCCTTCAGCGAATTTCCTTTGTTTTTGTTTTTTGTTTTTTGTTTTTTGTT
TTTTTGAGATGAAGTCTTGCTCTGTCACCTAGGCTGGAGTGCAGTGGCACAATCTTGGCT
CACTGCAACCTCCACCTCCCCGGCTCGAGCAATTCTCCTGCCTTAGCCTCCTGAGTAGCT
GGGATTACAGGTGCACACCACCATGCCCAGCTAATTTTTGTATTTTTTTTTAGTAGAGAC
AGGGTTTCACCATGTTGGCCAGGCTGGCCTCAAACTCCTGACCTTGTGATCCGCCTGCCT
CAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCGCACCCGGCCAGCAAATTTCC
TTCTAGCCACACCTAAATTAGTTTTTGATTAACTGGGTACTATAGCCTTGTGAAGTCAAC
ACAAGTAACCATTACATCATGGGATGATGACATTATGATTCCTGAAAATATGAGCTGTGT
TTGTTTGGAATGAAGAGCTTGAAAAGGACAAGGCTTTGAGAATTCAAGAACTTGTCTAAT
GTGATAATAAAGATAGCCAAAGACAAGATGATTTCAGCTGGGCTCGGTGGCTCATGCCTA
TAATCCCAGCACTTTGGGAGGCTGAGGCAGGCGAGTCACTTGAGGTCAGGGGTTTGAGAC
CAGCCTGGCCAACATGGTGAAACACTGTCTCTACTAAAAATACAAAAATTAGCCATGTGT
GATGGCAAGCACCTGTAATCCCAGCTATTCGGAAGGCTGAGGCAGGAGAATCAGTTGAAC
CTAGGAGGCGGAGGTTGCAGTGAGCTATGATGCCACTGCACTCCAGCTTGGGTGACAGAG
TGAGACTCCGTGTTAGCAAAAAACAACAACAACAACAAAACTGCACTTATGTATGTTTTT
GTTTAACTTGTGGACAAAGACTTTAGGAAAGGTGCAAAAAATAAATCTTCTTTTGCAACC
CAGAACTCATTGTTCAGTATGAGTTTTGATACATATCAGAATGGATACTATGATACCTGA
GACAGTTAACTGATGGAGTATTGATAGCCATAAAGGTTGGTCCCAGGCCAGGCACAGTGG
CTAAAGCCTGCAATCTCCACACCAAAGTGGGAGTATTGCTTGAAGCCAGGAGTTCAAGAC
GAGCCTGGGCAAGAACGTAACAAACACCTCATCTCCACAAAAATTTAAAAATTAGCTGGA
TATTGGGGCATGTACCTGTAGTTGCAGCTACTCAGGAAGGGGAGGCTAAGGCAAGAGGAT
TGAGCCAGGAGTTGGTGGCTGCACTGAGCCTTGATGGCACCACTGTACTCCAGCCTGCGT
AACAAAGACAGACCCTGTCTCTTAATAAAAAATGATTGATTCTAGAACTGTAGAAGAGAT
AGTTAAACAGCATGGGATATGAGGGAAATCCTCAGCAGTATTAATTTTGCATTCCAATTT
CATGTTGACGTGATACAGACAATGACTTTTTGTTTTAAAGGCTTTTATCTTGAGAACATG
GTATCTGGAGTTAAAGGTATTGGCGTATTCCACACATCTGTACTATTCTTGAGTGTGATC
GCTTAGGAATAAATATGATTTGAACTCATTCATGTTAAGAGAGGGTGTCAAATTGAGAAC
CAGGCAGATCCACCACCTACAGTAAAAAGGACTTTAAATTGGCTGAAGAAATTAGATCCC
AAAGATTCTTGGTGAATTTTGAAGTCTTCATCAGTATATCCATATTAAAAGATGACAGAA
ACCAAAATAAAAGAATTATGGGCTGACAGGACAACTGAATTAAAATTAGCATTAGTTTCA
TTAAAAAGGGCTAACTTGAAGATCAATCTTTTGAATCCAGCTCTTTAGAGGATCTAAAGT
CACCTTGATGGACAGTGGAACAAATCACAACATGGAATTCCTTGAATAAAGATTTATTGA
CTTTAAATAATTTAGCCTAATGTTACATTTACACAATTTTTTTTAAAAAAACCTCTTTAC
ACTGTTTCTAAAACAAACAAACAAAAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved