Homo_sapiens Locus Mono:283:AC087763.10
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:283:AC087763.10
Homo_sapiens
Mono:283:AC087763.10
8
SNORA70L5
1001..1134
2134
ACAATAAGATTTTCTTTTCTATCGCATTGTCAGGCTGCAAATTTTCCAAACTTTTATGC
CCTGTTTCCCTTTTAAATCTGAATGCCTTTAACAACACGAAAGTCTCCTCTGGAATGCTT
TGCTGCTTAGAAATTTCTTCCCCCGGATACTCTAAATCATCTCTCGCAAGCTCAAGGTTC
CACAGTCTCTAGGGCAGGGACAAAATGCCACCGAGTCTCTTTGCTAAAACATAACAAAAG
TCACCTTTGGTCCAGTTCCCAACAAGTTCCTCACCTCCATCTGAGGCCACCTCAGCCTGG
ATCTTATTGTTCATATCACTATCAGCATTTTTGTCCAAACCATTCAACAAGTCTCTAGGA
AGTTCCATACTTTCCCACATTTTCCTTTCTTCTTCTGAGCCCTCCAAACTGTTCCATCCT
CTGCCTGTTACCCAGGTCTAAAGTCATTTTCACATTTTCAAGTATCTTTCCAGCATCACC
CCACTCTACTGGTACCAATCTACTGTATTAGTCTGTTTTCACACTGCTGATAAAGACGTA
CTCGAGAATGGGCAATTTACAAAGGAAAGAGGTTTAATGGAGAGCTCACAGTTCTGCGTG
GCTGGGGATGCCTCACAATCATGGTGGAAGGCAAGGAGGAGCAAGTCACATCTTACGTGG
ATGTCCAGAGAGCTTGTGCAGGTAAACTTTATTAACTATCATGAGAATAGCATGGGAAAG
ACCCGCCCCCAAGATTCAATTACCTCCCACTGGGTTCCTCCCACAATGCATGGGAATTGT
GGAAGCTACAAGATGAGATTTGCGTGGGGATACAGGGCCAAACCATATCAGATTTTATTT
TCAAACGCATTTTCTTAATAATACAAGGTGCTTTTTAAAGAAATTATTTATACATATTCC
AATTGGCATATATATTTTGTTACCATAAAAAGGTAATATACACATATGGTTGTATATGAA
GAAGAAACAGATAGTAGGCTACATGTAAAAATGATAAAGGGCTGCAGCCAATTGAGCTGA
TGGAGTTCCTTTCCTCCTGGGGCCCAGTGTGCAAAAGCTGCAAACAGCAGCTTCCTTGGT
AGTGTACGCAGCCTGTTTCTTATATGGGTTGCTCTAAGGGACCTTGGAGACAGTCATATG
GTTGTTCATGTCTCTGACCTTGCACTACCCTCAGTGCTCTGAATAGGTATTCGAGGTGCC
TTTGAAAAGCCCCAGGGTGCTGTGGCCAGGGTTCACATTGGCCAAGTCATCATGTCCATC
TGCACCAAGCTGCAGAACAAGGAGCATGTGATTGAGGCCCTATGCAAGGCCAACTTTAAG
TTCCCTGGCCGCCAGAATATCCACTTCTCAGAGAAGTGGGACTTTACCAAGTTCAGTGTG
GATGAATTTGAAGACATGATGGCTGAGAAGCAGCTTATCCCAATAACTGTGGGGTCAAGT
ATACCCCCAATCGTGACCCTCCGGACAAGCGGTGGGCCCTGCACTCATGAGGGCTTCTAC
TGTGCTGCCCCCTCCTAATGCCCACCAATAAATCCTACTTCCTGTCCACCTTAAAAAAAT
GACAAAGTGTAGTCACCTCTTGAGAGTAAGAATAGGGCTGGTGTGGAAGTGAGTTTTTAC
TTCTCACTGGACATATTCCATGTTGGAAAACTGTTCTGAAGTGGGTATCATTTTTATAAC
ATTTAAATTTCAAAAAATATTTCACTGTGTGCCTAGTCTGTGCAAGGGGAGAATGCAGAG
GAGGGAGGCATTAGAACCACACGTGAGGAACTCTGGAGTCCAGTGTGTTTGACTGCAGAA
AGCCATTACTTATCATGTTTGGCTAATAAATACTGTGTGAAGATTACTTCTGATGTGTAA
TCTCTTAATTACAGATACACAAAAAAGGCCAGTCATGAATCACGCCAAATTGGAAGCAAC
CAAGATGTCCTTCAGCGTGTGAATGGATAAGCAAACTATGGTGCATTCAGGTAACAGAAT
ATTACTCAGCGCTAAAAAGAAATGAGCTATCAGCCATGAAAAGATGTGGGGGGTATTACG
GCCATATTACTCAATGAAAGAAGCCAGTCAAAAATGGCTACAGACATACAATCCAACTGT
ATGACATTCTGGAAAAGGCAAAACCACGGAGACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved