Homo_sapiens Locus Mono:7:AL160060.11
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:7:AL160060.11
Homo_sapiens
Mono:7:AL160060.11
10
SNORD115-48L1
1001..1076
2076
AGGTCACTGTCATAGCATGTCATGTAACATGGTCATGTCATGGTACACATCACACCACA
CCATGGTACATATGACATCGGGCCATGGTACATGCCATGTCATGTCATGGTACACGGGCG
GTGGCTGGAGGAGACCTGAAGGATCTATGAGTGAACCATTGGGATGCTGACACCCCACAG
TGATATCACTGGAACAAATGAATCAGGCCCTGGTGGACCCTGGTAAGACTGGAGACGAAG
GGGCCTTTCTGATCACCTGGTCTTCATGTAATGAAATGTTAGATGACTCCTGTAGAATAC
TCAAGGTCACAAAGCTTGTGGCGTGGAAGTGCCAGGCTGAAAATCCACATGCTCTGACTC
TCCCCAGGACAACTCCCACATTCCTGATCAGCCTGAGCACAAGAGAACCGGGGCCACTGT
TGTAAACTTGTCCTGGATTGAGGTCATAGGGCCTCCCAGCCCTGGCCCACATGGATGTCG
CTGGTAAAGGGGCCAGCCTGACCCCAGAAGGAGACATCAGGCCAGCTGCAGTTGTCTTTC
ATAAACCTTATGATTTCTAGGTCTAGTTTTGATCCCACAGACCTTGCTCGAAACCAGGGC
TACCCCCAGATATGAGTAACTAGGGCATAGCTAAGGCCATAAGGCTCAGAGAGAAGTCAG
TGTCCCTGGTGGGGTGTGGGTGTTGTGTATAAAAAGAAGCAATTGATTATTATTTTTCCT
TTTCTTCCTAATTCTCCCACCTTACTGGAGAGGAATAAGATATGGATGTGGCTACTTTGA
AGTGTGTAGGAAGCAATGACTCATTAATTCTATTTCTAAAAATGCACATGAAATTACTGT
GAATGAACTCAAGGGTGTTTACCATTTGTATACTGATACCACCCAATTGTCTGGCACTGA
AGATGTGGTGTCCAGTCCACTTTCCCACCAGTGTTTAAGGAAACCATCTCTCTTAAGCAT
ATTTGATCTAAGTGTGCATATGCATATGAGTGCCATGGGCTAGGCCAATGCTGAATTATT
ATCTTGACGAGAAATGATGACGTAAAAATTAAGCTTAGTAGGATTACACTGAGGCCCAGC
CTAGGTAACAATTGTGAGACAAGAAGTTTGGATTTCTTAGTTTCCTTCTGTGGAGACTTT
ATTTCAGGATTCTGGCAATGAAATATTTCTGTGAAACTTGTTTTGCACACTTCTATCTGT
GTGCTTCTAAGTAAACTATAAATTCTGATTCTTTAAGTGTTTAAGTTTCCTATAATTCCT
AATTTTCTTGGGTATTTGGCACTAAGACCCTTGCTCTCTTTCTCTCACTGGATGATTTAG
TAAGCCCTACTGGTGCTATTCTATTGAGTGGAAGTGAGCGGCTACCTTTGCCGGCTGAAA
AATTCCAAATAGATAATTGAACTAGTGAAGACTGAGCTCTATAATAATTACAATTATTCA
TTCAGACAACAAGAATATCATGACACGGTTTTCTCAATAACTGACAGACACATGTGATGG
AATCCTCATGAGAAAATCCTTACTTTTTACCTAGGATTGATTTTTTTAAGGGTTGAGAAA
TATGACACATTGGAATTTTGCTCAATGCATTATAGTCATTGAGGTCTAAATACAGACTAA
ATTTTCTATAATATTAGTATAGTATTCTAACAGTGCTAGGATATGTTTTGATCACTGATG
AATCTTTATGACTGAAGTACCCTTGCAATTGGGGTATAAATGTGAGTTACAATAATATGT
GTTTTCCCATGAAACTTGAAATTGGATAAATTGATGAGCAATCTGGTACCTGACTTTTCT
CTCCCGAATACGTTTGGCTTCATTTTCGTTATGATGAAAGTGTATGCTGTGAACGATGCC
AATGGTAAATAAGACCTTTATGGACACTCATAAGAATGACAATCAGGGCCTTTCCTTCAG
GCAACATGATTACCCTTGTGCACTCTTCTTCTCAATGAGTGACTAGCATACTTGATGGGA
TCTGCAAGAGGGAAAATTTACTTTTTACTAAAATTGCATTGATATAATGTTGACAAGGCT
TGTGATTATTGGTATCATCTCTAAGAGGTGATATTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved