Homo_sapiens Locus Mono:115:AC093872.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:115:AC093872.3
Homo_sapiens
Mono:115:AC093872.3
4
2080
ATTATGTCCTTTGCAGCAACACAGATGCACCTACAAGCCATTATCCTAAGCGAATTAAT
ACAGAAATAGAAAATCAAATATCACATGTTCTCACTTATAAGTGAGTGCTAAATCTTGGT
TATACACATGCATAAAAATGGGAACAATAGACACTGGGAACTCTAAAAGGAGAGAGGGAG
AGGGGCAAGGCTTTAAAAACTTTCTATTTGGCACTTGGTTCACTATCTGGGTGATCAGAT
AAATAGAAGCTCAAACCTCAGCATCACACAATATACCCTTGAAACAAACCTGTGCATGTT
CCCCCCAAATTAAGAAAAAATAAAAATATTTTTAAAATCTCATTTTTAAAAACAATATGA
TCAATTAAAATAACTTAAATAACTTACCAGCAAAACATATAACAATCCAGAATTAAAATA
TTCAGAAAGCAAGCAAGTCATCTTGTACTACCAGATTCTTTTTGAAGAATGACGTTTATA
AAATGAAGAGAACCAATTTTACCTGCCTGTGCTAATGGAAAATAAGTTCAAGAAATGTCC
TAGTTATAATTTTCAGTTAGCCCAACATTAACATTGCCCAGAGTTTAGTGTGACAGCCAC
CTTGAAGCCCTTGTAAATTCTATCGCCTTGGATGAATCACAACTGATTGGTTTATCAATG
CATATAATTCAGATTGTTCTGAATAAAGGTGGCTTCCCTGAAGGACCCAAGATAACTTCA
TGAAATAAATGTATCACATCCAGTTAATAGATGAGGCAAAGAACATTATTTATTTCAAAA
GAGAAATCTTATTCTTTTGTGGTAGAGTAAAAGAAAGATTGAATACAAAATAAAATTGCT
AATTAAGAAAAAGGAAAGCCACCTATACTCATTTGCTCATGAAAAAGAAACCTAGCTGAG
AAGACTGGCAGGCAAGAAACACAGTGGACTAGTATTGCAGGAAGGAGAATGTTGGAATAG
AAAAGTTTATTTGTTCTCTGAGATCTGCTCTTATTGAAGTGGATCAAGGATGAAAATACC
CAAATTTGAGTATCAGAAGACCTTCCAGTCTACTTGATGCATGAGCTCTACAGTTTTAAG
AAGCAAAACTATAAAACAGTGTAAGAAGATATATTTTCCCTGACCTCTATTTGTGATTTC
CTCTATTTATCCTTAAAAGCAACTCTTACAAAAGCATAAACTTTATACATATTTGCATGG
TAGGCACATTCACATATTGCTGTTGTGTTTTTCATTTTACAGGAACAAAATATGTTCATT
AGTGGGAAAATAAAAAGGAACCATAGACAAGCAAAAGGCAGAAAATAGAAAACACTCAGA
ACCTCACTCACAGACCACTATCTTCAACTTTGTGTGCCCGCTTCTAAGGCCTAATCTTTT
CTTAAAAATTATTTAATTTTAAAATGCAGACTTAAATACACATTTCTACATGAACATGAT
CATATCAAACATATTTTTTTCAAATATTATTTATTTCAAAAAAGAAACCTTATTGCTTTG
TGGTAGAGTAAAAGAAAGATTGAATAGAAAATAACATTTCTAATTAAGAAAAAGATGTCT
AGGTGGCTGGCAAGATGGCCAAATAGGAACAGCTCCAGTCTGCACCTCCCAGCAAGATCA
AAGCAGAAGGCAGGTGATTTCTGCATTTCCAACTGAGGTACCCGGCTCATCTCACTGGGA
CTGGTTATACAGTGGATGCAGCACATGGAGGGTGAGCCGAAGCATGGTGGGGCATTGCCT
CACCCAGGAAGCACAAGAGGTCAGGGAACTCCCTCCCCTAGCCAAGGGAAGCAGTAAGGG
ACTGTGCCATGAGGAACGGTGCATTCCAGCCCAGATACTATGGTTTTCCCACAGTCTTCA
CAACCCACAAACCAGGAGATTCCCTCAGGTGCCTATGCCACCAGGGCCCTAGGTTTCAAG
CACAAAACTGGGTGTCCATTTGGGCAGACACCGAGCTAGCTCAGGAGTTTTTTTTTATAC
CCCAGTGGCACCTGGAATGCCAGTGAGACAGAACCATTCACTCCCATGGAAAGGGGGCTG
AAGCCAGGGAGCCAAATGGTCTAGCTCAGAGGATCCCACCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved