Homo_sapiens Locus Mono:212:AL138745.19
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:212:AL138745.19
Homo_sapiens
Mono:212:AL138745.19
X
2071
ACATTAGATGTGGCCTTAAACATTAAGTCTTATAAAATAGCTATCAACAACCAAAAAAT
ATATTTCATCTATACTTATTTTTATAATATTACTGCAAAAACAACCCCTCAGAGGAAAAA
AAAATCCATTTCAACCACCTGTTAAATTCTTGAAAGATCCAAGGTTATAAGAGTTTAGTT
AAAATTAAAGCTAAAATATGTATTTTAGTAACTAAAAATTAAATAATTAAATGTATTATA
GCAAGCAATATGTAAGTATAACTAAGATTATGCTGCTTAAATATGTGATATCTTCATGCA
TTGGACAAATATTCTTCCCTTTAAAGTGTATTGACATATTACACATTTCATTAATGTGTA
GCATTTATTCATATGTCCAAAGAAGGAGAAAGAAACAAAAATACGTCAATCTGGCTTTGT
GACTGGATTTCTCTCAGGTCACAAAGCCACAGTGGTATTACCACTGATATTTTCACCTCA
TAAATAAATATTTCTAGCTTAAAGCACTTTATTATGGGACAGAGAGCACCGAACCAAAAT
GAGATGTGACTTCTAGTCCTAACTATGACATATAGCTTCCCTGATCCTTTATTTCCTCAT
CTGAAAATGAGGAGGTTAATTTATTCAACAGAAAATATTGTGATAGATTGTATATTAAAT
TATTTTCCAATTCTAAAATCAATGATTCTCTATGCATTATATATATACATGTATTTTTTC
ATCTTTAACATCTCAACTATAAAAATTAATTACAGCATTCACTATCCTATCCAAGACTAC
ATTTACCATTTTCTCTTCATATTCTGGGTCCATTTCCTTTTCAGATTTAGGCGCTTTAGC
AGCAAGTTTGAGTTGAAATGAAGAAACGTTTTTCTAGAATTTCAAAGAAAATAAATGTCA
CCAAATTGCAAAGCAAGGTTCTTAAACTGGTCAATGCTCTCATTAGAAGAAGGCGGAAAG
TAATTACATAACTAAATATATAAATCAATGTGGGACATGTATGGACCAATGATGAGAGCA
TGTCACAAAACAAGGCTTATGATTAATCCAGTTCTGTACACCTGAGGTCCAATAAAAAAA
ATCTGAAAAATTGTGAATGCCAAAGAAATATTAATTGGAATAAAACCCAAAAGGCAAGAC
ACTGAGCTTTCTCATCCATTCTTTAATTTATAGTGTAAGAAAATGTGTAAACATTAAATA
AGAGATTTTAAAATCTAGAAAAGGCTAATATCAACCACAAACCAAATAATTCAAAGAAAG
TAAATATTAATTCTAAGAAACACTCCTTTATGTCATGGAAATACGCCACACTTTCAGAAA
AAAAAACTGTGGTTTCTGTTCCTAAAACGATATTTTTAAAATTGTTTTCATAGTATTATA
AGAATATTTAATTTTTTATGTAATGCAATGTGATCACATATACTTAATATAATAGTACAG
TTTTAAACTTTTGGCTTATGTTAATTTTCTCTAACTGGGAAGAAAACTACTTTAAACTAT
TTATATTGCATAAACATCTTGTAGAAGCAATTTGTCAAGGCTACTTAACTATTAATGTTT
GATATTTTTAAATTGTAATTTAGCGAAAACTAACATCAATCAATAACTTAATATAGAGAT
TATCTGGGGAAGGGGGTTATCTCATGCACCCTATCCTTTGTAAAGACAAGCCTGTACTGG
CAAATATAAATACATATATAGAATAAGCCTCCTTCCCTATAAGAAACCAAGAAATAAAAT
AATAAAAACACAAATCTACCCACCAGAACCAAAGATGAGAGCATTTCAGTTTTAACACAT
ACTTTGCATAAGAGAAAACACAAATTTGTTCGTGAAAACTATCATGGCTTTTGTCAACCT
ATTTATGAAAACTTAGGTCAAAAATCAACAGAATGTGACCTTAAACATAAGAAAAATATG
GCCCCCATTATGTCTTCCAATATTTACTAAAATTTCTATTTTGAGGAAATCCAAACTGAG
ATTATGGAATTTGACCTTGTCCAGACTCTTACTTTGTAGCACTGATCAGATATCATTCAG
TTACACTAACCCAAATAATAACCATCTTGATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved