Homo_sapiens Locus Mono:56:AC124861.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:56:AC124861.3
Homo_sapiens
Mono:56:AC124861.3
2
SNORD3@L32
1001..1227
2227
GCGAGGGGGATTGCTTTTCCACCCTCATGTGTTCTGAGGTCTGGGATGAGCCTGAGCAA
CAGAGAGGCCACTGGGAGACCAGCTGGTGTCCACAGGGGTGGGTGAGCCACCGAGAGGCC
ACTGGGAGATTGGCTGGTGTCCAGAGGGGTGGGTGAGCCACAGAGAGGCCACTTGGAGAC
AGGCTGGTGTCCAGAGGGGTGGGTGAGCCATAGAGAGGCCACTGGGAGACCGGCTGGTGT
CCAGAGGGGTGGGGGAGCCATAGAGAGGCCACTGGGAGACCGGCTGGTATCCAGAGGGGT
GGGCGAGCCACCAAGAGGCCACTGGGAGGCCGGCTGGTATCCAGAGGGGAGGGTGAGCCA
CTGGGATGCCCACCCTGAGATGGCAGAAACTGAAAGGCACGGACAGATGGGAACCCTGGC
ACAGTAAGGAAGGTTTTTAAATGTGTTTTTGTCAGGGACAGCAAAGTCCCCTTCAGGCCC
ATGTGCAGCCATGGGCAAGGCACCGCCCAGTACAACCTGCAGCTCCGTTGGCCCTGCCAG
GCAGGGCTTCTTGGTTTTAAGGACCAATGAGCTTAAGAATCCAAGAATCCAATGGATCTT
TTTCTAGTTGACCAAATGTTGTCATTAAAGTATAGTTGATTTGTATTTCAAGACAACCAG
AAAAGGTTAGCAGTTACTTTAAAAGATTAGAAACTGGCCAGGTGCCATGGCTCACACCTG
TAATCCCAGCACTTTGGGAGACTGAGGTGGGCGGATCACATGAGGTCAGGAGTTCGTGAA
CAACCTGGACAACATGGTGAAACTGCATCTCTACTAAAAACAGAAAATTAGCCGGATGTG
GTGGCGTGTGCCTGTAATCCCAGCTACTCGGGATGCCAAGGCAGGAGAATCACTTGAACC
CAGGAGGCGGAGGTTGCAGTGAGCCGAGATTACACCATTGCACTCCATCCTGGGTGACAG
AGCAAGAGTCTGTCTCGAAAAAAAAAAAGACTAGAAACGGAAAGCCTATGCATTCTGGGA
TCATTTCGATAGCTCGTTCCTGGAGAAGTTTCTCTGAGCACCAGAAGCCACAAGGAGCAG
GCCCAGCATTCCCTCCCGAGCAGGCCCAGCGTTCCCTCCCGAGCAGGAGCCGTCGTCTGT
GTTGCTTCCCTGCAAGTACCATTCGCCACTGATGACCATTCTTCTGTTCCTCTGGGAGAG
TAAGAGGGAGAGGATGTAGTCTGAGAGGTTTATCTTACTTGTTAAAAAAAAAATGACCAG
AAACGGAAAATATCATCACCCCAACGGCCTCTTCAGCCTTGCTTCTGTGGACACAGAAGA
CAATGGTTTGCTAGGGTTAAACTTGAGTAATTTCGCTCACTTGCTTTTTGCCAGAGAATA
GCACTTTCTTAATTAAGAGATGAACCCCCTAGGCCTGGCTGCCAAGGTTTTTATTTTTCA
TCCAAGTTCATCACCGAGTGCCTGGTTGACAAGCGCCCTGGAGGCAGGAGGCCAGAGGTC
TGATCTCCACGCAGGTGCAGCCACGGCGTGGGCGGGCTGACGGGTGGGGTGAGCTGAGGT
CCTTCCCTCCTGGGGTTCCAGGAGGAAACACGTAGCCCTGCCCAGAGTGATGGGAGCAGG
GCCTTTACTAAGGTGCTGCAGTCGGGTGTGGGGGGTCAGGAGGGGCCCCGGGAACTCAGG
TTCTGAAGGGGTGGGGGCCGTTGTCCTCTCTGAACTGACCGGCCAGTGGAGGGGCTCCTG
GCGGGCCATGTGAGGAGGGGGCTGCTGCACCATGGCCAGGGAATGGCCACAGCCTGCCCG
AGCCCCCTCCGGCCCCCTGTCATCTGTCACAGCCGGAGTCTCTGCTGCCACGGCTCTGGC
ATTTGGACCGGGTCCACAGCATCTACAGGCCCTCGGATGCTGGACAGTGTGGAATAGCTG
GAACAGCTGTGCCCCACGCTGGGGAACGGAGGGCCTGGTGAGACAGCCCCCTGCTCTCCA
CGGGCCTCACACACCTGGCCTGGCTCTGGCCAGCTGGATCCCACGGGCGGAAGGCCTGGC
CAGGTCCTGCCTCTGGGGCCCCCTCAGCCCAGGCTGATGTCTCAGGGTGACCCAGTTCCT
CTTCTCGAGTCCCGAGTCCCGAATCCAGCACGCCCCATGGAGTGGCTGCCCACAGGCCCC
AGTCACGTCGCCCCTCTGGCTAGAGCCGCTTGCAGCCTGAGTGAGCCAGGCCGAGGGCCA
GTGGCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved