Homo_sapiens Locus Mono:34:AC073875.6
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:34:AC073875.6
Homo_sapiens
Mono:34:AC073875.6
2
SNORD78L1
1001..1065
2065
CTAGCTCCTTTAACAATACTGGAACTAGAAGTTGTGGACAGCTCGTATTCATCATTCAA
GGTAGCAGCTTTACCTGGGACTCTTTCCCCACATCTGGATTAGAAGTCCCAGTCAAAATG
CCATCTAAATTGTTTATAATTCTGCCACTATAGCATTTAACCCACTTTTGTGTTTATTTA
TTTAATCATTTGTCTTCACCAATCGATTGTAATCTGGCGAATGCATTGCCACCTCTATCT
CCCTAACTAAATACTCTTAGGAGCTTATCAAAATACATGACACACGGTGGGCATTCAACA
AGTACATCCTAAATAAATAATTAATTAATATGTTCATTTCAACATTTCCTTGTGCCTTTC
ACAGCAGATGTCTTCATTATTTATCTTTGGTAAAAATAATTAAGCAGTCATTTTGTAAAT
AGTCATGAATATTTACTATACTTTAAATATGTTCTAGGTAGCATGACATTTTCAAGGAAG
TATACACGAGGGTTTATTACTTTACTGAGAATAAAGTCTATGGGGCAGACAATTTACAAT
ACAGTGTGATAGAAATCTAAAGAGATGCCAAAGAGTTGGTCAGGTAATGTTGTGCTATGC
CAATGTTAAGAGTTCTAATGTTAGTATTCACATAACTAATTTTCATAGTCTCGAAATCTT
CTGACATTTTCTTCCCTTTGAAATATTTATTTTCAGGATGGTAAACTTTTTATTCACATA
ATAACTATTTTTAGGGATAAGAAGGTCAGAAGCACTAACTTTCTTCATTCCTTTCCTACC
ACATGTTTAGAATTCACAAACCAGCTTAACGGCTTAATAAAAGATTGAATTCTCTTTCTT
CTCCTTCCTCGAAATCTTCTCAAGACAGTCTAAAAAGCATTTCCCAGGTTTAATGTCAAA
ATAGAAATTAGCAACTCAGGGCTGAACTCCTAGGAACCCTCATTCTCTGTGAGCTCTGGA
ACCAGGCTCTATTTTGAAAATTGTGGAAAATCAAAGTTTCTCTGTAATGATGTTGCTCAA
ATATCTGACCTGAAATGATTATATAGACCAATTTAATACTGAAGAATAAAAGCTTATCAT
AAAATGAGAAGACATTAAACAATACTCTGATGGTAAGGATTTCATGTAAGAATGTATGGT
TTTGATCTCTTAGAACAAAATTGACATTGAACTAAGACATGCCAACCACTGAGGAGTAGC
ATGAGTTTTAGTCACAGCATCTTGAGTTTGGTGAGTTACAATAGAGAGCCTGTGTCACTC
AGCTCCACAAATTCTACCACCATGAAAAGTTTCCAGGGAGTGGTAGAATATGTTTGTCCT
CTTTTGCTTGCAACCCTGGTAAACTGCTCAAGAGGAATTTTCTCATTCCAGATGAGAACA
AATAATGCCCTTTCTCTTCTAGACAAGTGACTATTTCTTCCCCCAAAACCACAGATGCAC
AGAATAGTGATAAAAATACAAACTTATATGCTGCCTCCTATTGAAACTTCCAAAGACCAA
AAGAGGAAAAAAATTGTGAGGGGGCTTAGCCAAAAGACTTACTGAGGCTATACAGATTAT
CTTACATTCAGGTAATATATGATGCTGGTGTTGGGCTGATACATAGTGATGCTGGGGTAG
GGTTGGAGGTAAGTATTATACTAATAGTCACATATTCTCAGAAATCTGGGTCCTTTGAGG
TCTGGCCAGAAAAGGAATAGCAGTTCTGTCAGAGGACATAGTAACTGCAAGAAGAGTAGC
ACAGACTAGGTGCATATTCTGATGCCAGAAGACCTTTTCAGACAGGGTCAGCCTGTAACA
GAAATGGCTTTTAATACAGGACAGTCCAGATTCCCAATTGTGTTGACATACTGGGCTACC
CAAGCACATCACAGGTACAAAGGAATTAGGATGCTGGGGCTTATTTGGGCTAAATTACTC
ACAGGTGCTTCTAACAAAGGTGGCAGATTGAACATACACATTTACCTCTATATCCTCCCT
AAATCCCATGAAATGACCAAAAACGTGTGAAATAAACCCAAAAGACAAAAGAATTGAATA
GGAGATGACAGCGACCCAATTTTAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved