Homo_sapiens Locus Mono:287:AC108863.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:287:AC108863.4
Homo_sapiens
Mono:287:AC108863.4
8
SNORD38BL3
1001..1069
2069
AACTTTTTCACACTGACAACAAAGTTGGAAGTAAAAGTCAAACAAAACACTAAAAATAC
TCTCTTTTTTAAATTACACAGCTGTTGTAACAAATACTCACCTGTACCCCCTAAACATGT
GAAGTATTATATATCAATAAAAAAAGCAACATGAAAATAAATTATACAGCCATTATCTCT
AAAACTGATAATCCTGTAAATGCCAAAATAGGGACACATTACTTCTCTTAGTTAAAGCAA
AGCACTTAGTTCAGTTTCTTAAGTATAAATAAGGAAAATGCCCTCATGTGATCCTATACA
CGGAAATTAATACTATTCCCTTCTAAAGCATGCCAGGACCTGGAGGTTTTCCATCTCTCA
AAGTGCAATATAGGTTATCTCAAATTCTAGAAAGCAAAGCAATTTTATTAGCCAACAAAG
CCAAACCTTTTAGAGCCACAGCCCATTAAAGTAATCTGAAAAGTTCTCAAGAGCCTGATA
GGCAGTACAGATTCACTCAAAAAATTCAGCATAAGCAAGTCATCAGCAAGAAAAAGAAAA
AAAAATCATTAATAAAAGATAAAGTTAAAGGCAGTCACATTTGCTACATTTAGCTTCTGT
TGGTATTCTGGTGGTATAAAGTTTAAGGGAAAAAAACCATTTTAGTTTTAAAATCATTAT
TTAAGTAAAATCAATACAAACAATGTGTAGTTTAGATTTCCTTCATTAAATGCTCACTTC
TCATATCCTTTTCATGGAAAAGAAGAAAAATTGTCACCAATCTTACCCTTTCCTTGTCTA
CGACAATGAACAGCTCCACATACCGGGTCTGTGGCAAGACAGCTCTTCTTCTCTGTCAAA
AACACAAACATCATAAAGGCAAAAGGAAGTTATAAGGCTATGATCACATCCTAATCTCTC
ATCACTTATTTCATGTCTGCTAAGAACATCATAAAATTATTTTACTTAACATATCCTATA
TCAAGAAAGTGAAAAATATGTTTTTTGAAGTGTTATCTGCTTCTTAGTGATGAAAACTTT
GTCCAGTTCTGCTAATGACTTTAAGTGATGATAAACTATGTCTGAGGGGAAAAAAATGTT
TTTGAAGTGTTATCTGCTATCTGCACTAATATGAGAAAAATGTTAGTTACAGATAAAATG
GGTTTAAGTTTACAAAGCAGAATTACCAATTTTCTAAAATCAAAACTACACACACACACA
CATGCAAACACACACATATTTTAATGAAAAAGCCCATTACTATGCTGAGAGATAAAGAAA
ACATATCCACTAATATCCCAGAGCAGAAGTTAGAATAAGGTTGCCATTTTAAAAAATGAC
TAGTTTTGTCATTTTACAGAAATTCATGCGAAGTAGAATAAGCAAAAATTTTAATGTTTT
CCAATGTTTAAAGTTAAAAAGAATAGCCCAAGTCAAAAGAGTGGATAGCAGCAGAGGCAA
TAAAAATAATGCCATAAACTAGTATAACTTAATTAAAAATATGCCTCTTTCAAGGCAGCA
ACAGAATCTCATATGTAGAAAGGTACAATCCCTGCAGCTGAAGTTGATCTAGTCCTAGAA
CCATTTCAGTCTAAGAGACACCCATGTCAAGAGTAAATCATGAAGTGCTATAGCAGTCTC
CAAAGAGGGACTCAGACATAGTTTATCATCACTTAAAGTCATTAGCAGAGTGTCCTTGAA
ACACATCTGAAGTCATTAAGTTCCTAAAGCCGTATCTCTCTCTTTTTCCAATCTAGGGTT
CAAGAATCACCATTTGAGTTGTCTAAGAGGTACCTAAATAAAAACTCTATTGCACTGGGT
GCAGTGGCTTATGCCTATAATCCCAGCACTTTGGGAAGCTGAGGCAGGAGGATTGCTTGA
TACCAGGGGTTCAAGACCAGCCTGGGTAATGTAATGAGACCTCATCTCTACAAAAAGTTG
TTTTAAATTAGCCAGGCACGGTGGGTGGCACAGACCTGTAGCAGTAGCTACTGGGATGCT
GAGGCAGGAGGATTGCTTGAGCTCAAGAGGTCAAGGCCACAGTGAACATTGTTGCAGATT
TAAGTCCTAGTTTCCAAAACCCACAGGATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved