Homo_sapiens Locus Mono:156:AL355821.9
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:156:AL355821.9
Homo_sapiens
Mono:156:AL355821.9
13
SNORD38B
1001..1068
2068
GGAAAAAAGAAAAAAAGGCTCTTTATATGCCAAATTACTGAGAAAATATTCAGCTATAT
TTTTTACTCTTTTTTTCTTTTATGTAGTGAACCTCAGGTGTAAACTTCTGGCAGCATTTT
GATCAGATTTAGAAAATAGTTGAAAGAGGAAGAACAAAGGGAGATGATATAAATGGCAGA
AAACTTAAGGCATCTTTGGATGAAAAAATAACCTGAATCAAGAAAATGTAATTTTTGATG
GTGATTACACTTCGAAGAAAATAAAGTGGATTGAGGAGCCAGATATGACTGGGCAGGAAA
TTAGATAGGATAGACAAGATGACCTCTCTAAAGGGGGCTATTGAGCTGATACTTGAATGA
TAAAAAGGAGCAGGCTATCAGAAGTTACGAATCAAGTGTCTTTCAGAAAGAGGAAAACAA
AAAATAATGGAAATAGGGATAACCCATTAGAGAAAATGTGAGAAGGCTTACATGGTTGGA
ACAAAATGAGTAAGGGTAAGTTTCAGAAGAAGAGAATAAAGACAGGGAACTATAAGGTGG
GATGAGATAAAGAGTTTATACCTTATTTTGAGTAATGGGAAATAATTATTGGGTTTTATG
CTGGATAATATTTGTAATCTGAATTAGAATGTGAAGATTACTGCAGCTGTCTCACAGGTC
ATCAATAGTTCTGGGAACAGGAGAATGTTTTGGGAACTGTTAGCAGGTTACTGGAAAGTT
TATGTAAAAGATGTTACATACTTTAAGTAGGATCCAGGCAGTAGTGTTTTAAGAAACAGT
CCAGTTTGGATACTTTCTGAAAGAATAAATAGCAAGATTACATAAGGATACAATGACTGG
AAGAATCAAGGAGAAAGCCTAGTGTTTTGGTCTAAGAGACTGGGTAAATTGAAGTAGTAT
TAACTATGATGTATAAAACGGACAAAAGCAATTTGTGAGTGGATAAACATCAGAATTTAA
TATTCAAAATTCAAGACCAAATACTGGAATTAATAAATTCATGTCAGTGCTGAAACTTTG
TCAAGTTATGCTACTGACATGAAGTAATGATACAGTATATCTGAGGAGAAAAAAATAAAT
AAATTCACCTATTGGGAAAGTGTTGTTGGAGGAGAGAAAAATGACAAGAACTGAAAACAT
TTGTTCTCCGTCACTTCGTGGTCTGGAGTAGACAGAAGAGCAAAGGTACAAAGAGTCAGC
AGCTGGTGAGCCTTGAGGGATACTAAGAGAGTGCAGTAACATGGAAACCAATGCCAGTGT
TTCTAGAATAAGAGTGTTAACTGTGTGAATGCTGGTGGGAAAGTTGAATATGGGTAATAG
ACTTGAATAGACAATATGGTGCACATTGGTGACCCTATAATGTTTCAGAGGTGTAGTGAC
AAGGATGAACGGAGGAGATTGAAGAGAATGTGCAGTGGATGAATGCGGAAATTGTATCTG
AGTCCTTCAAAAAAAATTTATTCTAAAGGGGGACAACATTTATTTGGTAGTAGTCAGAGA
AGTATGATGTTCAAGAATATGGGACCCATTATAGCAAGTGATATGCAAATAGTAATGTGT
TTCCAGATGATTTTTCTAGTCAAAAACAAGGTGGGAAAGAACTTTCTAGTTCGCAAAGTA
ATTAATGTAATTAATAGATTCTTATTATAATGAAATGCATTTAAAAATGTCAGCATTCCA
AGAGACAGTATTTTCAACAAATTTATTTTTATGTTTTTATTTTTAACAATAATAGTTAAC
ATTTATAAAGTAACTGCATTATTTTCTTATATTTTGGCTGATGAGGTTCTTTGAATTTTT
CAAGTCTATTAATTGAAGACTTCCCCTCAACTCCCTCCCCATATTCTAGGAAGGATAGAT
AAGTATAGGGATGTACATAGTTCATTGTTATTACATCACGTCCTGGTCTGACCAACTATT
TCCTTTAAAGTACTGCTAAAACTTGTCTACATTTTATAATTAAGGTGAATGTCAGTAATT
TCATCAAATTACAACCTTTTGTTATTATATTATAGTGAGATGTGTGATTTCTGTATCCTC
TAATAGAAATATTTCTAATAGCAAACATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved