Homo_sapiens Locus Mono:169:AC107024.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:169:AC107024.5
Homo_sapiens
Mono:169:AC107024.5
3
SNORD6L1
1001..1072
2072
TTTACTGAATATTTTAACATCATATTATTGATATCTGCTATAGGAATTACAATTGGCAT
CTTAATTTACAAACACAGCAAAAGAAAAATTTTGATTTTTAATTTTTTAAATAATTTAAT
GTGGCAACTTGGAAAATCAAACACCACTACCACCCAAGATATGTTGGGCTTTGCTGCTTC
TTGTTGTTGTCCATTCTGTTTACTTCTTTAGTGACTTTCCTGCACTACTTCTGTGAAGTC
CGTATCCTATGTCATTTGAGGCCACTGAAATCTCTGCTTGGTTAGTTTTGTTATTTGGCT
AGTAATTAAACAGAGATTTTATTAAATGCCATTAGCCAATAAATCTCCCAGTCTTTGCCT
AGGAGTTCCATGTGTGTGTGTTGGAGTACATTAGCATCAACTGGTAATGCCATCTCAGGC
AGCATCAGTGTTAAACAATTGTCCCTGGTTGTTTGCCACAGATTCCTTGAGGATAGATCT
ATTTCCACAGAGTGAGCTCTTAGAGTCAGCTCAAATAATAGAGCTTTTCAGCAATCTACC
AGTCAGGTCAAATAGTGACAATTCCTTGGGGGTTAGGCTTTTGTGGAGCTTCAAATCTTT
TATTCATCCTCCAGTAGCTACTATAATGTTGGTTTTCATAGCTACCATAGTTGTGAGGGT
ATTGGCTTTCAAAGCCACTGACGAGCTGGAGAGAGCAGAATGGGATTAGGGAAAGTTAAA
ATATATAACACTCACTCTTTTTACTGAGATTCGGCTGTCTTTGTTTCTTTAAATACATAT
CTTTCAGATGGTTTCAAACATATAGCAATTTTCAGTGTTCTAAAAATGTTAATTTTGACA
GTTTTTGTTAGTGTTCTTATTGTTTTTATGAAAAAGCAGATTTCAAATGTCTTTGCTCCA
CCATTCCAGATCATTCTTTTATTTTTGCAGTTTTTGTTATCAAAGTTCACTAAATTTCTT
GGCCCAAAAATATAGGCAAGTAGCAACTAAATATAGAGTAAAAATGTTATGATATGAGCA
AAATGTTCAACTATTCCAAATGGGCTGAGTGAAAATAGGTTTTCTGAGCATCCATTTACA
TTGGCCAGGCATAGTGGCTCATGCCTATAATTCCAGCATTTGGGAGGCTGAGGCAGGAGG
ATCATTAAAGGACTAGAGTTAAAGACAAGCCTGGGCAACATGGTGAGACCCTATCTCTAA
AAAAAATTTAAAAATTAGCTGGCCATGGTGAAATGTACCTGTAATTGTAGCTACTCAGGA
GGCTGAAGTGGGAGGATTGCTTAAGCCCGGGAGTTTGCAGCTGCAGTGAGCTGTTATTGC
ACCACTGCACTCCAGCCTGGGCAACAGAGCAAGACCCCATCTCTAAAATAAAGAAATAAA
AAGGTAGAAAAATATCAGAGTTGGTGGAAAGAGGGACTAAGAGAGGTGCAAATGTACACT
TAAAATCCATGCATTTCCTTGTATGTAAATTGTATATCTAAATATTGAAATATAGTAGTG
ATATGTGTTCTAAAGTAATTAGATAAAAATATGTTAGTGTCTGCAATGTACTTGAAATGT
GTTCAAAATCAGGTGGATTCACAGATACACAAAGGAATTGATAGGTATGAAAACACAAAA
ACAACAAAATAACAAGCTTAGTAAAGTTAATAATACACAGGTATTCATTGTAAAATCTCT
TAAATTGGCATTATTTTTGAAAAATATCTTAATAAAATATTGTGAGTAAAAACTTCTCTT
CAGACAGATATTAGTTTGAAACATAATTTTAAAAAAACAGCATCACAATAGAAATGACTA
GTATTTTTCCAGAGTTAAGAAACTTTAGAAACATTGATAGAAAGCTAAAAAGATAAAAGC
CAATCTTTGTCAAAGGGGCTCAGCTAAAATCCTTCAGGAATTGAGGAAATGTTTTTTTTA
AAAAAGCTACATCTCTCTTAATCTGCGAGAAGAGAAATTAGTACCATTTACAGCTTTATA
TAGGTGACATCTTAAAGGTTTCTCTGTAATAGAATGAAAACATGAAACACTGCTTTCCAT
TTTTTAGTACCATTTCTGTAAACGTAAGAGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved