Homo_sapiens Locus Mono:180:AC125618.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:180:AC125618.1
Homo_sapiens
Mono:180:AC125618.1
3
SNORD118L7
1001..1136
2136
GATTCCTCAGGGATCTAGAAATAGAAATACCATTTGACCCAGCCATCCCATTACTGGGT
ATATACCCAAAGGATTATAAATCATGCTGCTATAAAGACACATGCACACATATGTTTATT
GCCACACTATTCACAATAGCAAAGACTTGGAACCAACTCAAATGTCCAACAATGATAGAC
TGGATAAAGAAAATGTGGCACATATACACCATGGAATACTATGCAGCCATAAAAAATGAA
GAGTTCATGTCCTTTGTAGGGTCATGGATGAAGCTGGAAACCATCATTCTCAGCAAACTA
TCGCAAGGACAAAAAACGAAACACCGCATGTTCTCACTCATAGGTGGGAATTGAACAATG
AGAACACATGGACACAGGAAGGGGAACATCACACACCAGGGACTGTTGTGGGGTGGGGGG
ACGGGGGAGGGATAGCATTAGGAGATATACCTAATGCTAAATGACGAGTTAATGGGTGCA
GCACACCAACATGGCACATGTATACATATGTAACAAACCTGCACGTTATGCACATGTGCC
CTCAAACTTAAAGTATAATAATAGTAAAATAAAATAATAAAAATAAAAATAAAATAAAAA
AATAAAAAGAAATGGTTTCTTCCCCTTCCCTCTATATTCCTTCAATTTATCTTTCCTCTA
AACACAAAAGAAGGGGAGAACCCTAAAGAGAAAAAAATCAAATGAGCACTATAGTAATTT
TTCAGAACTTCAAAATGAATGTAAGTAAATTAAACTCTTTCAAAGCTGCACATATAGCCC
TGAAGAGGCCCTTCTGTTAAATGGTTAAATAAGAAGACAAGAACACAAAGCAAACTTATC
CATAGCACGTATCCAATGTCTGTGTAAAACCCTTGATCTGTTCACAGGGAGATGGCAGCA
AGATAGCCAAAGAGCAGAAGCTTGCCAAACTAAATAAAGAAAATCAAGACAAAGAGCAGG
AATAAATGTAACAAAGATACCATAACGATATCTTGGAGTTATGGTCAGGTGGAATAATCC
TTATCTGTTTCTCCTTTTGAAGGGCAGATTAGAACATGATAATTGGAGTTCACATGATAC
ATGATTAAAGTCTCTGTGTAATCATGACTTACAATATCCTGATTATTCCTATCTTATTCT
TCCCGAAAAAAATATATATTAGAGGTTTATGGCTAAAATATGGGATGTGGGTGATCAATA
GCCACAAGGAGCACCTGATGACCCTTTGATTAACCTGGGACCCCAGGTTTTGAGATATGG
ACCAAAGCTATAAACTGTGAAATAGTCAATTATGTCTGTAATATGAAAGAAACTGCTCTT
CCAATTTTGGTTAATGATAGGTTTTTTTCTATATAAATGATGATCTTATCAACCAAATTA
GGGGGATTTTTAAAATTCATTTTATAAAATATAGTTTAACTCAAGTGACTCTCTAGTTAC
AACCTGCTTGTGGATCTTAAGTATAGCTACTTCAATCCTTTTTGCCAATGCCACTAGATT
AATAGTTCTCACCTACCAAATGGCAAGGCTTCCATCCTTTCTGATGTCTCTTAGATACTC
CAAAGTGGATGGGGACTATCTCACATAGAATTTCCACAGCTTCCTGTGTCTCTGCTATCC
TTATGCTCTGGCGCTTTACATTCCTCTTAGCTAATTCTGCTTAGCATAGAGCCCACATGG
TGTCAATGGCCTTTGACATCCTTTGGAGTGTCTATCTTCTCAAATTCTGATGCTTGGGAT
GACATCCTACCTGCCTCCAAGTTCCTGTCATAAACACCACCTGATACTTTATTCGGGTCA
CCAATACCTTGGTGTTAACCCAACCTTGACCTCCAGTCCTCACCTCTCTCTGACTGGTAG
AGAAATGATGTCCACATTTTCAACCCTTCCATGAGAAGGGAGAAGGAATCTGACAGCAGA
AATGTTTGGGCTCATAGTAATAAACTGCTTTTAACTTCGGCACATAACTATCTCTTTTCC
AGGGTCATAAGTGACCACAGAAGTCTGAGCTGTGTAAATTTAAAAGCAGCCTCACATTTG
TACCCTACATCAATTCTCTCTTCCCATTGTGACAGACTCTTTCATTTGTTGTAGTAATTC
TTTTCTCTAAGGAACCCCTTTGTCTCTTATTTTACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved