Homo_sapiens Locus Mono:51:AC006196.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:51:AC006196.3
Homo_sapiens
Mono:51:AC006196.3
2
SNORD59BL2
1001..1068
2068
TAAAATGAATTTCCCTCAAATGATTATTTTTCAACAAAAGTGAACACTTGACTTGTGAG
AAGAAAAAGTTCAAAATACTCCAAATTGTATTTTATGTGCCTAAAAAAAAAGATTATTAT
TATTATTTTTTGTACTGGTATTAAGCTAGGAGAAAAAGTTCTGTGAGTCTTCTATTATAA
GCTCTCTCCTCAAATGACTACATGAATATTAATAGATGCTTCATTAGTACTTTCATGTTA
TGGATTCTAGTGCTTCTTATGTTACTTGACAACATTAGAAATAATCACTACTGCATATTT
TTTGTTTAGATAATTACTTTGTAAAACATAGAAGTTAATTTATTTTAGATGTAGACAGTA
ATGGACATAATAAATATATGACAATTTGTTACAATTTTTTATATGCTTTGAGGAATTGTA
ACATTTTCTGGTTGAACTTGGCCAACTTCACAAATTAATATCATGATTTAAGTGAATTTG
GCATAGTACTCATTATATAAACCAGGAATAAAAATAGAAGCTGTCTTGAAACTAAATTTT
AATGACTCTTAAATTATAATTCGTTTAGTCTCATTTTGTTTCATTTCCTTGTTGTTGTCT
GGTTTTGTTTGGTTTTCTTCTACAGAGATGCTGAATACACAAATTATACAAAAATATTCT
TTTTGTTGTTGTTGTTTTGTTTTTGTTTTTGATTTTTTGAGATGGAGTCTCTGTCAACCA
GACTGGCGTGATCTCAGCTCACTGTAACCTTCACCTCCTGAGTTCAAGCAATTCTCCTCC
TCAGCCTTACATGCAGCTGGGATTACAGGTGCCCGCCACCACGCCTGGCTAATTTTTGTA
TTTTTTAGTAGAGACTAGGTTTCGCCATGTTGGCTAGCCTGGTCTCCTGACCTCAGGTAA
TCCTCCCGCCACGGCCTCCCAAACGGCTGGGATTACAGGGGCGAGCCACCACGCCCCGCC
AAAAATATTCTTTATATATCTTTATCAATACCAGCAGAAAGCCTCATTGATTAGTAGCTT
CTGACTTTTGTTCTGAGTTTGCTGAAGCTAGATGCCATTCCAGATAAGAACCAAAAATAA
ATAAATAAATAAATAAAAAGAAAAACAGCAGAAAGTTTTCTTTTAACATTTGAATTTTGT
TTATTTTAGGGGGAATTTTTTAATATGGTGACATTAAATTGCCTATGGTTGAGAGAAAAA
AATTCAAAGCTTTTAATTATTAAAATCGCTGTCTTCATGGATAATTAAGTTAAACTACCT
AATATGAAATCATGAGAATTCAAAGGTGTATATTTAAAAAACAGGGCTTTTAAAAAATGT
AGAAAACTTTAGAGCTACTCTGTGTCTGATCTTATGAATGGCTGAAATAATTAACCATAT
AATTCTATAACCCTAATTAACCATGAGTTATAGAAAATCAATAAAAGCTCACCTTCCCAA
ACTATTTTATGAATGTAATTGAAGTAATACCATTAAAACTGTATCTGTGATACAGCTATT
TATATCTTTAGGAGAAAGTAATTAAGGATGGAAAATAAATCCACTATTAGTCATTATTTT
CTCATTGAAGAGTTATTACCTTGAGAAGAAGGGATAAATTATAAGACATTGTGAAAATCA
TTTAAAAATCAATAAATAAACATTGATTCTGGAAATTAAAGAAAACCATAAGCTAATTTA
GACAAAACGTTTGTCTTCTACTCACTGCACACATATTCATCGAGCACTCCTCTGGGTGAT
AAGAATAAAAAAATGCATGCTTTCATGAAGCTTACATTCTAATGGGAATGACAGAAAAAA
GTAATTAAGCAAAATATGTAGAATATTGAAAGACATCAAAAGTGATAATTATTTATGAAA
TGAAATGGATATTGCTGAAGATACGGCTCATTTTTTCTTAAGACCATATAGTAACATATG
TTGTAATTATAACTCCTCTATGTTTTTCAGATGTAATTCACTGTTTCTTAAGATTGCTTG
TTTAGTCTTACCTTACTCCAGTTCAAACTCAGCTATAAATTTTTCTCTTTACAGGTGTAG
GTAATGCAATGCCCTATGTGAGGCAAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved