Homo_sapiens Locus Mono:52:AC010746.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:52:AC010746.8
Homo_sapiens
Mono:52:AC010746.8
2
SNORA4L2
1001..1137
2137
CCAGCTCCAAATTCACGAGCTTTATCAGTAATCTGACGCAATGCAGCCTGGGAAAAAGA
GCAGAGTAATAGGTGTGGTTTCTTTATAATCAAACATTTTGAATGAGCAAATTACTCAAA
GAAGATTTTCCATACTTTAATATTTTAGTGTTTACTTTTACACACATTTTACATAGACAG
CATGAGTTCATTTCCATCCAAATTACTCTGGAATTTCAATTCCTGTGATAGAAATTTTAT
GTTAACTCAAAAGAGTAATTTAATAGAACGAACCACAGAGGTATGTACTAAATGCCTTCA
TTTCCCTGAAGTATCTTCCATTTCCAAGGCACATATAGTGTTAACATAATCCCTCACATA
ATTTCACTAATTATCTTCAAGCTTTAAGCATATTTTAAAGGCCTTAAGAACAAAAAGGAG
AATCTCATTTTTCAGCATTTTTATTAGCTTTTTTAACCAAAGAATTTTGTGCTAACTCCA
GCTGGGCACGGTGGCTCACACCTGTAATCCCAACACTTTCGGAGACTGAGGCAGGAGGAT
CTCTTGAGCCCAGGAGTATTTAAATAATAATAAAAACAAACGGCTGGGCATGGTGGTTCA
CACCTGTAATCCCAGCACTTTGGGAGACCGAGGCAGGTTAATCATTTGAGGCCAGGAGTT
CAAGACCAGCTTGGCCAACATGGTGAAACCCCGTTTCTACTAAAAATACAGAAATTAGCA
GGGCGTGGTGGTGCACGCCTGTAGTCCCAGCTACTTGGAAGGCTGAGGCACAATTGCTTG
AACCCAAGAGGCGGAGGTTGCAGTGAGCCAAGACTACACCACTGCACTCCAGCCTGGGCA
AGAGAGCAAGACCCTGTCTCAAAAATATATATATAATATTAATAATAAAAACAAGCAAAA
AAGTTAAATCCTTCACACTACATAAATTTTTTCCCCTCATGCTATGTCCTTGATAAAGAT
GAAGACAGTAATTATAAATTCCTAAACACAAAAATATAACACTACCAAAAGTTAATTTTT
TATGGGGAAGGCTTTCTAAATAACCTTTACCAATTTGGGCTATTTGGGAGAGTAAAGGAA
AGACCACACTCCACAGCGGGCTATACCAATAGTTCACTACTATTTTGTGGTCTACATTTC
CTGGTGAAAAAATTAAAAACATTTTTAAAAATATAAACATGGCCAGGTGCAGAGCCTCAC
ACCTGTAATCCCAGCACTTTGGGAGGTAGGCCAAAGCAGGAGGATCACTTGAGACCAGCC
TGGGCAACATGGCAAAACCCTGTCTCTACAAAAACTACAAATTTTTTTTAATTAAATAAA
TAAGCAACAAACATGACAATTTAACAAACTGGGACTTACCTTTCTCATTGGTGGTGTTCC
ATTCTTAATTTTTAAAAGCAACTTCATTATTTTTCTCTCTTTTTGCTCTTCTGGACTAAG
TGTTGATTCATCAACATCAACCTATAGTAAAAAGAAAAAAATGTTAAGGGAAGTTGAAAT
GTTATGATTTATAATTCTGGAACACAATTAATAGTTTATTTCTGCTAGTATCACTTACCA
ATAGTTTATCAAAGTATTGAATATCATCAGGTTTTAAAAATGGAAGATTTCCAGATGGCT
GGTCATTAACACTTTTCATAGTTCGATCTTCAGTTTGCATGTGGAAACCAGTCATACCAC
CCAAAGGTGTTGGAGTAGCTGTCAGCTTTCGAGCTGGAGTTCGAATAGGAACATAACCAG
CTGGAGGAGGAAGTACCTAATAAAAGTTATAAGACAGTTTAGGATTTTCTTAACTTAAAA
AACAGCATAATGAACAATATTTGCACTTAAAATATTTTAGTTTATTAGCTAATAAGGTTT
TTATTTGCTTGGAGACAACATCTATCTTGCTTTTCTATCTTAATTAGAAACTTAAAATAT
ATACTTCTCATCCACTAACTGATTATATCCGTGGTGTAGGGAACTGAGGAAACACAAGAG
AAGAGCTTAGAAAATACTAATCACATTCAAACATGTTGTGGGTCAAAATGTCAAATTATT
AAAAATTTGAAAATTATAAAATCTGAGTCAGCAATTCCAAAAAATGCTGTAGTCGAGCAA
ATAATGTTTCATAAGATTTATATAAAATGGAAATAAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved