Homo_sapiens Locus Mono:312:AL078612.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:312:AL078612.8
Homo_sapiens
Mono:312:AL078612.8
11
SNORD3@L28
1001..1209
2209
AAATGCCTTCCCCTGGGGAAATCCAACTCATCCTTTTGTCTGGGAGGAAAAGCTGCTGG
AATAAAAGCAGGCAGAAGAACATGGAAGGACTAGACTTGCTGAGTCTCCTGGCCTTCATC
TTTTTCCTGTGCTGGATGCTTTCTGCCCTTGAACACCAAACTCCAAGTTCTGTAGCATTT
GGACTCTTGGACCTACACCAGTGGTTTGCCAGGGGCTCTCAGGCCTTCAGTCACTGACTG
AAGGCTACACTGTAGGCTTCCCTACTTTTGAGGTTTGGGGACTCAGACTGGCTTCCTTGC
TCCTCAGCTTGAAGATGGCCTATTGTGGGACTTCACCTTGTGATCGTGTGAGTCAATACT
CCTTAATAAACTCCCTTTCATGTATACATCTATCTTATTAGTTCTGTCCCTCCAGAGAAC
CGTGACTAATACATCATTCTCCACCCCTCCCTGTGTTCACATTGTTTGCCCCATAAGTCC
ACTCTGTCACTGGCACATGGCTTGCTTTGGCCAACAGGATGTGAGCAGATGTGACACAGC
AGATCTTTACAAAAGCACTTGCACTTTTCTGCTTAGGCCTTGCTGGCTGAGTGGCCATAA
GCACATGCCTGGGCTAGCCTCCTGGAGTATAACTCCCCTGGGACAGCCAAATTGTCCTAG
TTATCCCAGCTGTGGCCATCCTAGCAAAGCCAATAGCCAACCAGTCCCAAGCTTGTAAGT
GAGCACAGTCAAAACAAGGAAGACTGCCCAGCCAACAGCAGCTGACTGCAGAGGCATGAG
CGAGCCCAGCCCAGCAGAGATAAGCTAAGCTGAGCCCAGGTCAGCTAAGACCCTGCACAC
TTGTAAACAACACAGTTTATTCTTGCACGCCAATGAAATTATTGAGGTTGCTCATTACAA
AGGATTAGTATGTCAATGGATATCTGGTAATAAATGCGGTTTAAACATCCAGCAATTGAG
GAATGCTGCAATACCTTGCAGCAATTAAGAAAGCTGGTATAAAGACTATACTTTCAGGGA
TCATTTCTATAGTTCATTACTAAAGAAGTCTATCTGAACATGTAGAACACATGACACCAT
AAGGAGGAGGCACAACATTCTCCCTAGAGCCTGAAGCTGGCTCTTGGTGTTTCATGACTA
CAGCAGCCATTTGCCACTGATGACTGTTCTCTTCCAGGAGAATAAGAAGGAGAAGATGCA
GTTTGGGTTGTTTAAAAAAAAGAATTCTGATGCAGATGTATATTGACTTGAAATGTTCAC
AACAGACTGATAAATTGTAGGCGGAATGGGAATGGGAAGCAGGTTGCAAAACAATGTATG
TAATATGATACCATTTTCATAAAACATATATTTACACATTTGCATATGAATGAGTCAGGT
CTGATACACAAGATGCTGAAAGTGGTTATTTCCAAATGGTAGGATTTGGGGTGATTTTCA
TTTGTTGTTTATCTGTGTTTTAGAGTTATTCTATAGGAACATGTGTCATTTGTACAATTT
TCAAAGGGGAGAAAAAAATCTTTTCCATAGAGTACAGCATTAAAAAATTTTGAAATCCTT
TAGCTTATCCATAACAACCCTGAGTGTGTTTCAAGTACTTTTTGTGGAAAAAGTCATTGT
CCGCTCTTGCAGCATCCTGTCCAGGAGACTTGGTAACACTGGCTTGTCCAGGATTCACTA
AGGGATTGCAGGTAGCAGAACCTGCCTGTCTGATCCCACTGGTAACCCTGAGCTCTGTGG
TTGGCAGTGGCTTCATCTTTCCAGCCCACACAGAGACAGCGAAGCCTAAAAGCTCCTCTA
CCTTGGAGGAGGCAAGGGTTGGGGTCACTGCGGTTCCCTACTATCCTAACAGCAGAGTAG
AGCCTTCCCAGTAACTTCTTGCCCACAGAGGTTAGTTATGACCTTTAGGAAAACAAAAGA
GACCTTTTAAAATTTCCTACTAACAGGAAGCCAAATTTCATACATTCAGAGTAAGAAATT
CAATGCCCCAAGGCAGGACAAGGATAGCTACCACCTTAATCCTTCTAAAGGATAAAAGGA
CTTCCTGCCGGCCTGCCTGCCTGCATTTCCTCCTTCCTTGCTCTATTTTTCTCTTTCTTT
TTCTCTCTCTCTCATTCTTCCTCTTTTCTTCCTTTCTTATCCCATTTGCAGTTAGGCTTT
TACCTAAAACAAATCCTAGTTTAAAGCAAGTAGATCCGTCCCTTTACTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved