Homo_sapiens Locus Mono:303:AC104040.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:303:AC104040.3
Homo_sapiens
Mono:303:AC104040.3
8
SNORA72L5
1001..1180
2180
AAAGCTCTTACTGGGCTGGTTAGCTGAGTCATTGCATGTAGAGGTAGAATAAAGGCAGC
ACAGGCGCAGTCATTGATCATGCTGTGCCACTGATTATGACCAGCCCCAGCAAAACAAAA
ACAAGATGGATCCAGAGATGCCTGAGTTGCAGGTGAATTTGGCAAACTCTCATCATTGCC
ATACTAAAAACACAGCCCAGGGAGGAGCTTACTCTCCATTTTCCACACATGCGTCTTAGG
TAGAAGCATGATCAATGACTGTGCCTGCACTGCCTTTACTCCACCTCCATATGCAATGAC
TCAGCTAATCAGCCCAGTAAAAGCCTTATTTTCACCTTTGTTCAGGGAGGCACTGCTTTG
GGGGACTACCTCTGGTTTCTTCCTTACCTGTTGCAAGTAATAAAATGTCCTTGTTAAATC
CTCCTTGGTTGTGGTCATTGGACTGTCACCCACCAAGCAATTGAACCCACCTGTTGTGTC
GGTAACATTACTGACAATACCAAATGTTGGTGAGGACAATATCAAGTATTTGTGTTGCTT
TCATATGTAGCTTGTAGGAAACATTGTCCATTTCTTTTTTTTTTAATAGTTTAACTTTTA
TTTTAGCTTCAGGGGAACAAGTGCAGGTTTGTTATATAGGTAAACTCACGACTCAGGGTT
TTGGTGTACAGATTATTTCACTTACCATGAGATCCAGAAGTCCCACTCTTGAGTTTTTAT
TCCGGTGAGATGAAAACTTATGTCCATGTAAATACTTTTATGTGCATTCATAGAGATAAT
TTATAATATTGCCAAGTTAGAAACAACTCAAATGTCCACTAATAGAAGAGTGAATGGAAA
ATGTAATGGAGAGCTAGTCAGCAAAAGAAAGGAATGATCTACTCATATATTCAGGAACAT
GGATCAATCTCAAAAGCATTGTGCTAGCGAAGGAAGACAGACACAAAAGACTATATTGTG
TATGTACACAATTAATATTAAATTGTAGAAAAGACAAAACTCTGCCAATATTCTCATTGC
TCTGATTTTGTAATAGTCAGGACAGCCTAAACATTTGCTATATTTTTTTAATTTTTAATT
TTAATTTTTGTGGGTATAACATTCACTATATTAAGATCATGCATGTGCCCCCAAACCTAA
TTCTTTTCTTAAGTCTAGTTTTATAAATGCTAATGATGAACGCAGAAAAGAAAAAGGAGA
TAAAAAAGACAAAGAAAAGGCATAACTTTAGTAATAGAAACAGCTCAATGGTTTCCCAGG
GCTGCATTTGGGGGAAGACATTAATTACAAAAGGTCATGAGGAAAGTTTCTGGGGTGATA
TAAATTTTCTGTATCTCAATTTTGGTGGGTAAGTGGCTATACCAGTTTGTAAAAACATAT
GAAATATGTACACTTAAACAAATTTTATTTTATCCAAATTATACTTACAAAATGGCCTTT
TTAAATGATTGACAGTAGCAAGTACTTCTGGTTAAGCACCTGGCTGAGAGGTGAAAGAGG
TTGAACTCCTATACACTTGTTGATGAGAAAGTAAAATGGAACAAACACTTTGGGAAACTG
ACCACTTCCCTCTCAAAGCTAGATACATTATTCATTAAATATTCCAGGAGTTCCATTCCT
AAGTATTTGCCAAAAATAAATGAAAATGTACCTTTATGCAAAGGCTTGTACAGAAATGCT
TATTGAAGCTTTATTCACAGTAGCAAAAACAAGAAAATCGTATATACAAGTATTAATCAA
GAAGTGAACAATAAATAAAATGAGGTATATCCATATAATAGGATAACAATATAAATGACC
ATAACAGTAACAATATAAGTGAGCTATAGATATGCAAAAACATGGATGAATCTCAAAGTC
GCTATGTAGATTGAAAGATGCCATATACAAAAAGTCCACATTGTACAATTCTACTTACAA
AATTTTTTAAAATGCCAACTAATCTACAGTGAAAGAAAACTAATCAGTGGTTGCTTGTCC
ATAATGTTCACTGCTGATGGTCCAGTGCCTCCCAAAAGCCTTACACATAACAGGAATGAC
AATGATGATGATGATGATGATGATGATAGTAACTATTTGATATGTATTTATTGAATATAT
AATGTATTAAGAGACTATTAATAATGACCCTAACTCCTAAAGTGGTATTATGGTGGAGGC
CCTTTATAAATCTCAACACCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved