Homo_sapiens Locus Mono:290:AC090919.6
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:290:AC090919.6
Homo_sapiens
Mono:290:AC090919.6
8
SNORA7A
1001..1145
2145
ACAATTTTGTAAGTTGTTTCTGTATTTGCATTTGTTTCAAATAAATTTTTCTGTCTCTG
CTTTAATTTTGTTGTTTATGCAAAAATCACTCAGGAGTAAATTGTTTAGTTTCTACGTAT
TTGTGGTTTTGAAAGTTCCTCTTGTTATTGATTTCTATTGTCATTCCAGTAGAGTCTGAG
AAGATGCTTGATATAATTTCAATTTTTCAAATTCGTTGAGACTTGCTTTATGACAGATCA
TGTGGTCAATTTTAAAGAATGTTCCATGTGCAGACAGGAAGAAGGTATATTCTGTGGTTG
TTGGGTGGATTATTCTATAGATGCCTCTTAGGTCCAAATGGTCAAGTCTCAAATTAAAGT
CCAGAATTTATTTGTTAGTATTCTGCCTTGATAATCTGTCTAATGCTGTTAGTGGGGTGT
TAAAGTATCCCACTATTATTGCGTGCCTATCAAAGTCTTTTGTCTAGAGATAAGTGTTTT
ATGAATCTGTGTGCTTTGATGTTAGGTGTGTAAATATTCAGGAGAGTTAGGTCTTCTTGA
ATTGAACCCTGTATCATCATGTAATGCCCTTATTTGTCCTTTTTTTACTGTTGTTGGTTT
AAATCCTATTTTATCTGATAGAGTAATAATGACCCCTGCTCTTTTTTGTTTTCCATTTGT
CTGCTATGGAAAACAAAAGTAAATGGTTTTCCATTTCCATCTCTTTACTTTGAGCCTTTG
AGTATTATTACATGTGAGATGGGTCTCTTGAAGGTAGCAGAAGAATGGGTCTTGTTTTCT
AAATACAATTTCCACTCTGTGTCTGTTAAGTGGAGTGTTTGGGCCATTTTATATTCAAGA
TCAATATTAACATGTGAGGTTTTGTTTCTGTCATGGTGTTGTTAGCTATGTGTTTTGTAG
TCTTGATGGTGTAGTTGCTTTACAGGGTCTCTGGGCTATGTGCTTGCATGTGCTTTTATG
GTAGCAAGTATTGTTCTTTCATTTTCATGTTTAGAACTCTTAATCTCCTGGGATTGTGTC
TGGCGAGTGCCCAGTATTCTGCCACCTTCAGAAGGAAGGGAAAGCAAACCTTCATGAAAG
CAGAGGCATTCATTCCATTCCCAGCTTGCTCCAGATCTGGCAGTTGGAAGACATTCTGCA
ACAATGTCAAATCAGATGAACAAACAAAAAAGAACTCCCTTAAGCATCTCTTACGGAGCC
AGTCTGGTAGTGATAAATTCCCTTAACAATTGTTTCCCTGAATTTTATATAATTCCCTGA
ATTTTATATAATTATATAATTCCCTGAATTTTATATAAAATATGAATTATATATATGAAT
TTTATATATATGAATTATATATATATTACATGCAATGAAATAATAATTATATATATGTAT
ATATATTCCATTATTTCTGTCCCTCTAGAGAACCCAAATACAGGTGTAAACATGATGTAA
GATTGTCCAGGGAAAATTTTCTGAACTGTGATGTTGGACATGCCAGAGGAGACTTTTACT
GGAAAGAATTTTTTAAAAAGTATTCCCTGGTAAACATAAATTGCCACCACTTTTGCTATT
ACATCAGCCAGGTCACTTCCATCAACACAATTATTATTATTACAGAGCCCTGATTTTCTT
CTTTCACCACACTTTATAATTACTTACCTGTGCAATGTGTAGGACACCTTGAAGATGAGG
GAAATTACAGACTTACTCCTTCTGGTAATGGCATTATAGGTACTTTGTACCAACATTGCC
ACTGAGAACAACTAAAACTGCCAGATAAAATAAGGAGGGGAAAGGCCATGATGTTTGTGT
ACTCCTGGTAGAGAGCACAGAAGGTCAGCAGAGCACTAAAGGTCATTTTTTTAGGGGGTG
GAGATAGGCCAAGGGCTTACTTTTAGCAGGCTCAGGAGGCCCCAGGACAGAAATAAAGGC
TGAGATAGTGCTCAGTGAGGAATGTAATTGAGGAAACACTGACACTTTATGCTGAGATCC
TAATGGTTACATTTCAGAGTCAGTGTGAACCAGTTTCGATTTGTTTTACTCCTACTCCAA
ACCGGGAAATTGGGCAGCAAGCAGATTAGGGGATGAACAGTAAAGGAAGGCATCCTGGCC
TGAGAAGTGTTGACCTTTGTGCCTGTGAAGTGCCATGCTTTCATGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved