Homo_sapiens Locus Mono:77:AC011749.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:77:AC011749.2
Homo_sapiens
Mono:77:AC011749.2
Y
SNORA20L4
1001..1132
2132
GTTAGGAGTGAGTTCAGTTTTTCTGCAACAATTATAGTACATATTACTATAATAATTCT
GTTTGTAGCTACTGAGTGGCAGAACAGGAAGTGGAGTATGGCATGCATTTGAATCTGCAT
ATGGATTTTAGCATTTGTTTCCCCCTAGATTTGTATGTTGAAACCTAATCTTCAAAGTAT
CAGGAGGTGGGAAATTTAGGAGGTAATGACATCATGAGAGTGAAGCCCTTGTGAATGGGA
TTAGTGCCTTATTAAAAAACATCCCCAAGGTTTCCCTTGTCCCTTCCATCATGTGAGGAC
ACAGTAAGAAGGCATCAGGTACGAACTAGAAAGTGGGTCCTCACCAGACAGTGAATTTGC
TATGCCTTAATCTTCAACTGCTGCCCATCAGAACTGTAAGCAATAAATGTCTGTTGGTTA
TAAACCATGCAGTTTATGGTGTTTTTGTTATAGCAGCCTGAATGAACTGAGACATACTGG
GTCTGTCTATGTCAACTAGAGGACAATGCCTCTCAGAATTTTAGCTTTTTAAAATCATAG
CAAAGGAAAAAATATATATACATTTTAGTGATCATAGAAATTTTTCTGGTAATCTCACCT
AGAAAGTCAGCATAAAGCCTACTCCTTCATTTGTCCACTGAATTTATACACCATTGCAAT
CACTTTAGGATTAAAGTGGATCTATTGTGTTTAGCTGAAACAGGAACAGAAAACAGTCTT
CTGAAGATGAATGCAAAGATCAGAACTTATCCAGAAGTGTGCCAAGGATTCCAGAAGTTG
TAGTAATGAAGACGGTAAGGTGAATACAGAGGGATTAAATATTGATGGGTTAAATAAGAG
TGATTATTACTAGAACTAGGAAACATGTGAGAGACATGCAATTACAAAACAGTGGATAAA
AGAAAGATTTTTTTATCAAATAGTGCCAGGATACTAGGGAAAAAAAAAATTCACACCTTA
AAAATTCACTTCCAGAGAGATCTTAATAATTGATCTTGTGCCTTCCCATTTATTTGCTGG
TATAATGATACAATGATATGAGCAGTTATACTCTTTGGAAAAAATAATATTGGGCCATTG
TAAATTGACATGAAGTAAGTATTTTCATATCATCTGCAATGGACTAGATGTTGCTTTTGG
GAGAAAAAGAAAAGCAAGTAAAAAGATATATCTTGTGTAAAATAAAACCTTAAAATATTA
AAAAAAGAATGTAGAATATATTGATGACATCAAATTAAATGAATTTACATATATATATAT
ATAATTTTTTTTTTAAGACACAGGGTCTGGCTGTGTTGCCCAGAGTGGAGTACAGTAGCA
CAGTCATGACTCCCTGCAGCCTCCACCTCTTGGGCTCAAGTGAGCCTCCCATCTCAGCCT
CCCCATAGCTGGGACTACAGACATGAGCCACTGTACCCAGCCAAATATTTATTAAATAAA
GAATAAAAATAAATATAAAATAAGTAAAGACAATGATTAAGTTTTCACATTAAAACTTTA
AATGCTCTTAACAGTTGTTATATGCATAAAAATTTAGGCTTCTATATGTCCCAGATTGCT
GAGAAATACTAGTGTATCCTGTCACTTTCCAATGTATTTCTATTTGGGGTATAAATAGCT
TATTAACCTAAACATAAAAATCAGAAGATAAATATGTGAAATACATTATATTCTTCAAAA
CTCAATTTTAAAAAACCATAAAATATTATTTGAGTTTCAATACTATATTGAAGACAATAA
AATATTTATGGCCAACAAACAAAATATAATCAATCTCATCTGTACCTTGAAAAATAAAAC
TAAAGTTTAAAACCTTACCATTTTAAACCTGTGAGATTGCACGTATTTAGCAATCTGACA
ACAGGTATGAAGTCTACCTAGAGGACAACATCAACTCACATACTATGAATCAGAGTGTGT
TTTATTGTATTATCTTTGTAGAACAATTTGGAATTATCTGAAAAGTAAAATATACATCAT
AAACTCATTCTTTTGCCTTCTGGCTATATTTCCTAAAGATACATGTAGGATTATATTTTT
ATCGACATTGTTGATGAGAGCATTAAAATGGGTAGAACTCACCTCGTAACCATCTGAGAA
GTTCTTCCAGCCCACTGCATAAAGAAAGGTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved