Homo_sapiens Locus Mono:154:AL139003.9
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:154:AL139003.9
Homo_sapiens
Mono:154:AL139003.9
13
SNORD37L1
1001..1066
2066
ATGATGCTATGAACATTTGTGTACAAGTTTTTTTATGTAGACATATGTTTTTAATTCTT
TTGGGTATGCACCTGAGAGTATTAATAGAATCTCTGGTCATATGCAAACTCTGTGTTTAA
TTTTTTGAGGACCTGCCAAACTGTTTTCCAAAATGGCTGCATTTTATAATCTCACTAGCT
TTGTGTGAGGGTTCCAATTTCTCCACATCTTCACCCAGACTTGTTCTTTTCTATAGCTAC
ATATTTGTATCTGTGGGGAAGCAGCTCCACATTACATTTATTAAATATTTAGTAAAGAAT
CTCTGCTTTTGTACATCTCTGTTTCCATGATTATTGTCCATTCCAACCTCATCTCGTCTT
TGAACAACTGCAGCAACTCTTAAATGCTTCCTTCATGATATCCTTATGTATACAATAGCC
ACAGAGATCTTTTAAAAATGTATGTGGCAAACACAAACGTTATTTCAGAAAGCACGTGTG
CTAGAATTTTTTCTGTGAATACTTCTGTATCTGCAATAAAACATCAGTAAAATCTAAGTT
TTTTTCAGGCTCTTTGAATTTAGATTTGTAGTTCTTTTAAATATATCTCTGAGTTTTGAT
TTGCTTTAACACTGGTGATGGAAGTTGTGGTTCATTTGGGTTTTATCTGCAAAACATTTA
GATTAAAATGGCAGTAAAAGTCAAGCATTTATAAGATGATACTAATAGCTAACTTATATT
GAGTACCTACTACGTACTGAGCAGTTATCTAAGTACTTTCTATATGTTTAACTCATTTAT
TCCTCATAAAAATTCTGGTGAGGTATTATTAAACTTATTTCACACTACAGGGGAATAGAG
GGACAGAGAAGTTAAGTAACTCACCCAATGTCACACAGCCAGTAAGTAGTAGAGTCAAGA
TTCTAACCAAAAAATCTGGTTACAGAGCCCACATCAGTAGCCACCAAACTATCCTGCCAT
TTTGTCTTACTTATTGTCTGAAATATATAAGACTTAAAATAGTAGGTGACGACCAATATT
TTTTTTACTTTGACTTGATGTCTATTGAAGAAATCTAGCATCTGAGACTATGGGGAAAAA
AAAGAAAAACTTTAAAAAATTAAAAAATTAAAAGTTAATCATTTTCTGGTATTCAATAGG
GTAGTTTAAAATATTCACACTTTTATTAATTTTGAATAATATCACCATGTCCAATTATAA
GGTTGTATATTTTAAACATCCATGTTTCTATAATACCACCTAGAGGTTTACAGAATTACT
TCTGCCGTACTTAAAAACAACAGCTTGAGCAAAAAAGTACTGGACAACTTAAAGGATAAC
TTCTAAAAGACACTCTTGGAAAAATAACATTTTCTGAAATGTACACAATAGTCAATGTCA
TGATATTGCCTGCCAGTTCACGTGCTACTCTTTCCTCCACGTACGTCTTTTAAACCATCT
AACAGAACATTGTGTGTTTCTGAACATTTACATTCAATTTGTTAAATGTCACCGGGGAAA
AATAAAACAGAGAGGACATCAGCTAATAATGTACTTTTACATTCCGTCATCCTATGCATG
GTTCCATGTCTTACCATGCTGACCTAATTTGCCATGACAGGAACATGGCCCTGATTTCAG
AACATTCCAACTGTGGCAATCACTAAACCTTATTGGGAATTTTTGCCCCCTTAGCAAATT
GAACCAGATTGCTTTTCTCAGGACCATTTGAGATGGGTATCTGTGAGCAAGGCGGGTGGG
CTGTGATGAAGAGTTGAGAAATGGAGCTTTTATATTACAAATATACTGAAGCTTTATGTA
AATGTGTATCATTACAGGGTGACTGATTTTTGCTGTGAAGGTAGATTTGGGGAGAAAAAA
TTTAAAAATCATATTTTATTAATACTTCCTAATGTGTGGCCTTGGGCAAACCTCTTTCCT
GAGTTTCCTCAAGTCTAAAATGAGGATGATAATGATAATATCTATATTTCAGAGTTTATC
AGACAATTAGATAAGGATTCACTCTAAGTAAGGATTTAGAACAATATCCAGCTTCAAAAA
ATATAAATTCTGATTGTTATAATTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved