Homo_sapiens Locus Mono:200:AC112497.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:200:AC112497.4
Homo_sapiens
Mono:200:AC112497.4
X
SNORA7B
1001..1139
2139
GAGAATTTAGCCCATGACAAGTTCCATCAGTACTTCTCTCATAGGCACTCCATATAAAT
GTGAGATCTCAGTGAAAGGGGAGCTTGCTGCCAAAATGTAGTTTCAACACAAGTCCCGTA
TAATCTCTCCACCCATCAACAAAGAAAATTTGAAGCCACCACTGTCTGTGAGGGTAGGCT
TTCTCATTGACTACTGAAAACTAGAAGGAATGTTTCATATATCATTAATGGCTATTTTGC
TCATAGGATGGAATTTTTTTTTTTTTTTTGAGACAGGGTTTTTCTATGTCACCCAGGCTG
GAGTGCAGTGATATGATCATAGGTCACTGCTGCCTTGAACTCCTGGACTCAAGTGATTCT
TCCTACTCAGCCTCCCAAGTAGGTGGGACAACAGGTACACACCACCGTGCCCAATTAATT
TTTTAAAAATGTTTTGTAGAGACGGGGTCTCACTTTGTACTCAGACTGGTATTGAATTCT
TGGTTTCAAGTTATCCTTCCACCTCAGCCTCCCAAAGTGTTAGGATTACAGGTGTGAGCC
ACTGTGCCCAGCCAGGATGGATTTCAAACTAATTTACATTGCAGTGAAACAACTCCCTTG
GGCATGAAGGAAGAACTGGCTTTAGATGTTCCCTTGTACTATCTGTAATATAACTTCAGA
TAGGAAAAGAATAACTTGCTGAAATACAAATAAAATCCAAATCCTCATTTCGGTGAAGAA
TTTTAGGATTCTCTTTCCTCAAAGTTATTTTCATAAATATAAGGAAAAATAAATTTGAGT
TTCACTATCCCCTTGGTGCCTTTCCCTGCTTAAGTAGCAGAAGCACACAAAGACCTCTAA
TCTACAAACTTGAAAATCAAGAAAGACTATTGTTGATTAAGAGTTGGTACATGCTGTAAA
GATAGGGAAGGCTTATTAACACAATGTAGAGATGATGAATGAGCCTGTTCAAGTGTAGAT
AACAATGATAAGCTCAGAGCAGCAGATAAAAATGAAGATCCTACCTCCCAGGATGGCATC
TGGAAGTGGATAGTATTCTGCCAGCTTTGGAAACTGGATGAAAAGCAAATCTGGCAGAGG
TACCCATTTCATTCCCAGCTTGCTCAGTAGCTGGTGATTGGAAGAAACTCTGCAACAGTG
TTCAATCCCTGGACAGGAAACCCTCCTTCCATGATTCTTCTTTAACATGGGTCTGAGAAA
AAGAGAAATACAGTATTTTTTAAAATGAAGATGCTAGCCAACTCTCACCAGAACACATAC
TTAAATTGTTTTTCAGATCTTGAGGATGATTTAACCTGATCTGTCCTTTCATTGATTCCT
CTTAAAACCAAGAGCTTGAGCTGGCTGGGTAGGGGTCCAGTTTTGGTCACAAAAGAAAGC
CCCAAGCTATTTAGATCAGAACAGGATTGATGTAGTTCTAGATTGGGTTGGGTATCCTGC
CAGTGGAACCAACTTATCCTGGGCAAGTGTGAACAGATTGAAAGCTTGTTCATTGAAATA
CATAGCATACTTCTCCTAGGGCATTCAAAACATTTCAAAGAAAGAGCCTCCATGCATAAG
TGAAATTGAGCATATATACTAATGAGAAGGTGTACAACTCACAAGAGGATAAGGAAAGAG
ATAATAGCTCTCAACATATGTATACTCTGTGACCCAAATTTCTATTCCTAAGTAAATACC
CAAGAAAAAGCATACAGAAAAAACACGTACAAGAAGGTCCATAGCAGTTTAGCCACCTGT
TGTGCATGTATCTGACACATAATAGGTGCTCAATAAATGTATATAATTGAACATATCTTT
ATATCCCACATATGGTTTCACAGGCCAAGTGACACATACTAGTTGTGTCATCAGTTCATA
CTTCTAGCATGTACTATAAATACTTTAATAAAAACCATTTTATTAACAATTTCCATTTTA
GTCTATTATTGCTTTAATAAAACATTGGAATGAGGTCTTTAGGAATGATTTACTCAAGCT
TAAGATAACTATGCAGAAGGGCCCAGCAATAAAGAAAGTGTTATTAGAAAGCAATTTTTT
CAAAATGAACACTCAGGTACTTCACTTACCGTTTTAGTTGCCAGAGCTGCTCTGTCTCAC
TCTAAAAGCATTTTCTTGCAAAGGGGTTGGTTTTGATCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved