Homo_sapiens Locus Mono:2:AC011774.9
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:2:AC011774.9
Homo_sapiens
Mono:2:AC011774.9
18
SNORD23
1001..1104
2104
TGGAAGGCCAAGGCACAGGAGGATTGCTTGAGGCCAGGAGCTGGAGTCCAGTCTGGGCA
ACAAAGGGAGACCCAGTCTCTACAAAAAATTAAAAAATTAGCCAGGCATGGTGGCACATG
TCTGTAGTCCAAGCTGCTTGGGAGGCTGAAGTGGGAGGATCGCTTGAGCCCGTGAAGAGG
GGTGGTGTCAAGCAGTGAGCTATAATCACGCTACTGCACTCCAGCCTGGGCGATAGAGTG
CAACACTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGAAGGAAGGAAAGAAGGAAG
GGAGGGAAGGAGGAAGGAAGGAACGAACGAACAAACCGAGTTCCAGGGAGAGAGAAACTC
GCCCAAGGTCACTCAACAAGGTTGTGGCTGAGCTGAGACTTTTGAATCCAGTACCAATGG
GCCTTCCTCTAGACCCCCTTACTGCTTCCTGTGGTGTTAGTGACAAAATACTTAGGATAA
ACCATTTCAAATGAAAGATCAGCTGGCAAGCTTGAGCTCCACACTCATCTTGACAGGCTA
AGATTTAAACTCAGAAAATCATACAACTAGGGGCTGCCAGTGTTGCCAAATCTTACAACC
ACTCACCTAATGATGTGGTTTTGAAATGTGATGCCAGGAAACTGACCTTTCCTGTGATAA
GCTCATAACTAATTTCTTTCAAAAACTCACTTGTGGTGAGCATGCTCTCTGCCAGAGCTC
GGGACTGGTGCTGACCTGCAGGATGGAGGAGAGAAGAGAAGACTCATCAACAGAACAAAT
GTTGCTGGAACATTACTTATAATGGCAACAATTGGAAACAATCAAAGGATGTCACTATAG
GGACTTGGGTTAAGAAAATTATGACACATCAAAAGGTATGGACAATTATATAGCATTTGA
AATATCAATTCTGACTCTAGACAGAAACAGAAATGTTTATAATACAGATGATCAGGGGAA
CAAAATGATGTACCTTATGTAACTGAAAATATGCACGTTTGTGTTTAATGACTAAGGAAG
GTCCCTGTCCCCGCCAGGGGCTGTGAGCAACACCATGGCTGCCCCAGGGCTGGCCAATTG
GGCAGATGCCCAGGGGCTGAGAACATGGGGGAAAAACAGACTAGGGAAGAGTATGAAAAA
CCTTATAAAAATTGTGCTTGCATGGTTATAATGAATTTGCTTTAAAAATATAAACATGTT
TTTTACAAATAAAAATGAAAAAATATTAATGTATCACACTGATGAAGCTTTCTGGAAATA
CATGTAGCACAGAAAAATGGGCAGACAGGTTTTGTCAAAGTGAGGGGGTTTTCTTAGCTT
CTTTGCTGGAAGAGGTGAGAGCCATTCAGTACAGAGAAGAGAGAAGCAAAATGTAGTCCA
AATGGCTACCCAAGAGGGTGCCTGATAGAAAATCTGCACAGTGCAAAACAAACAAACAAA
AATCCCCTCCCACCCCCCAATTTTGTAGTGTACCAACTTTCTGAATCTTTTCTTTAGAGA
CTATGTTACAATATTAAATAGACTGTTCAGTGAGAAGGGGAATATATGAGCTAATTTTCT
GGCAAATTCGATTAACTGGCTTAGGCCACCTGTGGCACTGGCTTTATCACATGCTAGAGT
AGTAACATTTCCAAAATCTTTAAAGGACAGCAGTTACATGAGACAGGGGTATCTGTTACT
AGGGAGAGCTTTGAAATAATGCTCCCACAACCAGCTGACAGGGGCACCAGCCAAACTGAG
GGCTACACAAAACCTGATCTGAGAAGGAAAGGGAAAGTTAAAATTAGGAGGATGAGCCCA
AGCTCCAGCAATTAATCAGAGGTTGATTATGTGGATGCCTGAAACACATAACACACATTT
TTAAATGGAAAAATGGTCGAATGAATTGATTAAACAAACAAAAAACAAAAAAATTACTCA
CCTAACACTACCACACAAAATTCATTTCCTCTGATTTTCGATGCACAAATTACCACCACA
TAATCTGGCAGCCTTTGATAGTGTCTCATTTCACTGAGAGTCCTTAAGGTCTCTGAAATG
CCCTCCGCCAAAGAGTTCTGGGTCACAACCACATGAACCAAGTCTTGAGATACGCTGGCA
ATTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved