Homo_sapiens Locus Mono:46:AC019070.7
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:46:AC019070.7
Homo_sapiens
Mono:46:AC019070.7
2
SNORA48L7
1001..1135
2135
AAGCAAATTAAAAGTGCTACTTCAGTTAATACACAAATGATAAGAAAGCAAAACAGCCT
TTTTGCTGTGAAATAGCGTTTTTGCTGATAAACAGTTTTAGTGGTCTTGGGAGAAGATCA
AACCAGCCACATTTCCTTAAAATAAAGTCTAATTCAGAGCAAGGCCCTAACTCTCTTCAA
TTCTCTGAAGGCTGAGAGAGGTGAGGAAGCTGCAGAAGAAAAGTATGACCCTAGTAACGC
AAGGTGGTTCATGAGGTTTAAGAAAAGAAGCCATCTCCACAAAAGTGCGAAGTGAAGCAG
TAAGTTCTGATGGAGAAGCTGCAGCAAGTTATCTAGAAGATCTAGCTAAGATCATTGATG
AACAAACAACAGATTTTCAGTGTAGTTGAAACAGCTATCTATCTATTAGAAGATGCCATT
TAGGACTTTCACAGTTAGAGGAGAAGTCAATGTTCAACTTCAAAGCTTCAAAGGACCCAC
TGATTCTCTTGTTAGAGGCTAATGCAGTTGGTGATTTTAGGTTGAAGCCAATGGTCATTA
ACCATTCCAAAAATCCTAGGGCCCTTAAGAATTATGCTAAATCTACTCTGCCTGTGCTCT
ATAAATGGAATAACAAAGCCTAGAGGATAGCACATCTGTTTGCAGCATGATTTGCTGACT
ATTTTAAGCTCACCGTTGAGAGACCTACTGCTCAGAAAAAAATACTCCTTTCAAAATATT
ACTGCTCATTGACAGTGCACCTAGCCATCCAAGAGCTGTGATGGAGATGTACAAAGAGAC
GAATGTGTTTTCATGCTTGCCAAAACCATAGCTATTCTGTAGCCCACGGATCAAGTCTTT
CAACTTGAAAATGCATCAATTTTAAAGTCTTTTTAATTAAGAAATACATTTTGTAAGGCT
ATACCTGCCATACACAGTGTTTCCTTGATGCATCTGGGCAAAGTAAATAGAAAACCTTCT
GGAAAGGATTTACCATTCTAGATGCCATTAGGAATATTCATTATCTCTGACCTGGGTAGA
GCAGCATCTGGTTGGTGGTGCCCATCTCATATCAGCCAGAGATACAGCAATTCCTTGTTT
ATCCCAGCTTGGCTTTTAGTCTGTGCCCATGCCTGGTTCACGTGTGAAAAATATGGGGGC
AGGAGGGAAGAATATTCTTGATTCATGGGAAGAGGTCAAAATATCAACATTAACAAGAAT
TTGGAAGAAGTGAATTCCAACCCTCATGGATGACTTTAATGAGTTCAAAACTTCAGTGGA
GGAAGTATCACAGATGTTGTGGAACGAGCAAGAGATCTCTAATTAGAAGTGGAGACTGCA
GATGTGACTGAATTGCTGCAATGTCATGATAAAACTTGAACGGATGAGCAGTTGCTTCTT
ATGGCTAACAAAGTAAGTGGCTTCTGGAGGAGGAATCTACTCTTGGTGAAGATGCTGTGA
ACATTGTTGAAATGACAACAAAAGATTTAGAGTATTACAGAAACTTAGTAGATAAAGCAG
CAGCAGGGTTTGAGAGAATTGATTCAAATTTTGAAAGTAGTTCTACTGTGGCTAAAATTC
TATCAAACTGCATTTTATGCTAGAGAAATCTTACATGAAGGGAAGAGTCGACCAATGTGG
CAAACTTCATTGTCTTATTTTAAAGAACTGCCACAGACAACCCAACATTCAGCAATCATT
ACCCTGACCAGTCAGCAGATGTCGACATTGAGGCTAAACCCCTCGCTAATAAGAAGATTA
TTATTTGCTGAAGGCTCAGGTGATCATTAGCTTTTTTGTTGTTGTTGTTAGTAATAAACT
ATTTTTAAATCAAGGTATTTACATAGCTGTGAGGGAAATGGCTGCGCTTCAGTCAGGAGC
AGGCTGAGGTGGCCTTCTGGTGCAGCATGACTCAGCGGGTTTGTGGTGCAGGTGCACAGC
TCTGCACATTATGCAACCACACCACGTGAGGAGCATTAGATGATGACCTATGTGAGCTCA
TGCTTGGCTCAAAGCCACTATTGTCTGTAAAAGGTATAATTACCCCGGTAATGCTGCACA
TATGGCTCACTTGCACCCAGAGAGAGAGTAAAGCCATGTCAAAACTGTCTACAATTCCTC
GAGTGTTTTTCCTGCTACCTGCCACTCACCCACCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved