Homo_sapiens Locus Mono:204:BX295541.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:204:BX295541.1
Homo_sapiens
Mono:204:BX295541.1
X
SNORD3@L14
1001..1215
2215
CTTTAACCACATTCCTTGCACATGAACATGTTTGCTTTTTTTTCCCTTCCCTCATTGTC
TCCTTCCCATCTAATACCATTGAAGTTATAGACATCTGCATTTTTAGCAGAGTTTTATCC
ATTCGTTTTTAAAAACTTGAAAAATGCAGATGTTGAAGAAATAATAAGTATCCTGCCCTT
TTATACTTTGTGGCAGGATTGTGCTATAAGCAAATGAATCAAGCAACTATGTAAATCATA
AACAAAAACTAAAAACGAACCAAAGTAAAAAGGATAACTTCCAGGTAGCATCTTTCTATT
CTAACCTGTCATTTAAGGGAATACTAGTGATTTATTCTAAACAGGATGTAAAACTTACTC
CAGATTACTCTTCCTCTGTCCCGCCTGGCAAGAACTCAAGTATAACTGTGGTATAGCAGC
TCTTCCCAGGTATACTGGTTATACACAGGTTTGTGTGTGATCTCAGAATACACAGCCGAC
ATAGATATGATATGATAATTGGTAATGGCAAGTTCATTTACATTCTTTACACTTCTATGA
CCAGGCCTTAAGGAAAGAACAGTTTTTTAAAGAACCAGGTAGTGTCTTCCTACCTATCTC
CAAATACATGTCAAAAAATAAGGGTGTTTGTGCTTTGACTTTGTTTTTGCTCAGTAACAC
AGTCAAGCAACAGTTTGTTTCCAAGTGGCCCATTGAGCTGTGTAAGCATTTTTGTTTATT
TCAAATAAAGTGCATTGGTATCATTTGTTATTCATGCTATGCATCCATACCACGCTATCT
TCTGTATCAGGTAGTCTAACAGAAATGTACCCATGTTGTTAGAAGAAAGAAAGAAAGAAA
GAAAGAAAGAAGCAAAATACAAAGATTGGCAACCACCCCCAAAATTAATAACTCGTTTTA
TTACCAAAGCTGTGGAAAAGTAAACACTCTCATACATTCCTAATGGGTAGTATAAACTCC
AATAAAGGGCAATTTGGCATTATCTATCAAAACTAAGAATAAGGGCTATACTTTCAGGGG
TAATTTCTATAGTTCATTACTAGAGTAGTTTCTCTGAATGTGTAGGGTGCCAGAAACCAC
AAGGAGGAGGCACAGCATTCTCTAGTGAGTGTGAAGCCGGCTGTTGGTGTTGCTTCGCTG
AAACTGCCATTTGCCACTGATAATCGTTCTTCTTTTCCATCAGGAGACTAAGAGGTAGAA
AACGCAGTCTGAGTGGTATTTAAAAAATTACAAATACATAATTTTCCATAGAACCAGCAA
TTCAATTTTTGAGTGTTTGCCAATATATCTGAACACATATAAAATATGTACAGTGTTCTT
AATTTCAGCTTTTTTATAACAGCAAAAGATTGGAAATGATGCAAGTATCTCTTAACAGCA
TACCGGTTAGATAATTTAAGAATCATTCATACAGTGAAATACTATGACATATAAAAGAAT
GAGGAAACTTTATTTGTACCAATATGAAAAGATCTCCAAGATGTATTGCTAAGAGTAGAA
AAATCAAGGTGCCAAACACAGTATAATACACTATGTAAGAAAGGAGGTAAAATAAGAATG
TATATGTTACATAAAGAACCCTGAGGCTGGGCACGGTGGCTCTCGCCTGTAATCCCAGCA
CTTTGAGAGCCCAAGGCAGGCAGATCATGAGGTTGGGAGATTGAGAACATCCTGAACATC
CTGGCTAACACGGTGAAACCCCGTCTCTACTAAAAATAAAATAAAAAAAAAAAAACCTAG
GCGTGGTGGTACGTGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAGAAGAATTGCTT
GAACCCGAGAGGCAGAGGTTGCGGCGAGCCGAGATCGTGCCACTGCCCTCCAGCCTGGCC
AACAGCGAGACTCTGTCTCAAAAACAAAACAAAACAAAACAAAACAAAAAACCCTGAAAA
AAATATGCATTTACAGGGATTAACTGATTGGGGGAAGGTAGGATGAATTGGAAAGACAGG
AGAGGAATAGGAGCAAGACTTTTCACCCTATAACTTTCATTGTTGTTTCAGTTTTTGAAC
CATATGAATGTATTACTTATTCAAGAAAAGGTGAGCTAAAATTAAAGATGAAACGGACAT
TTTAGGCAACGATAACTAGCTGAAGAAAGAGGGGTTGTTCAATGAGTCCTTAAAGAATGC
AAAAAACTTTGTCATGTTCGAAAGAATAGAAATACTGAACTATGTTACATGTATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved