Homo_sapiens Locus Mono:6:AL157895.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:6:AL157895.8
Homo_sapiens
Mono:6:AL157895.8
10
SNORD3@L34
1001..1216
2216
ATGTAATTTGGCTGATAGAAATCATATTAAGTTCAATATAGCCATATGATATTTGGCTT
CAAATAAGACTGCTATTTAAAGAGAAGCTTAGGAAGGTACTGTGTCCTTATAATGCTAAG
CATTCATTGGAAAATTGGAGTTTGCCTAGTCCTGCGAAGTTCTGTTCCAAAAGGGAAATA
AGGCCACGTTAGAAATAGACTGGGGACAAAATTCTAGAGCAAAATTATAGAATAAGAGAA
TTCAGTGGCCACAATTCACCAAACATTTGAAGATATAACAGACTTTGAGGGCTTTCCTAT
TGGTTTAGAATGTCATTTTGTAAACTCACATTCATTCATTCATTTATTCACAAACCTCAT
TAAGATCCTAACTGATGCCACATATTATGTTACACATTGATGAGACAGATGGATATGACA
CTGTCAGAGCTCAGGCTGAAGATGTGCTATACATTAGTGAAGGAGGCTAGTCAGTGAAAG
TGAGGAATACTATATGAGCAATCCTGTGACAGAGACAAGCACCTCGTGTTAGAAGGCACA
TAGGGAACTCTCTATGGTGCTAGGGATTCTTTACATTTTCACAAGAGTAGTGATTACACA
GCCAAACTTGGAAAGACAAATAGTCATTGGACGAATAAAGCAGAGATCTGGATTCAAGTG
AAGTGAAGATTGTTGCAGGAGCAGAGAACAGGTCGTTAGAGTGAAGCATATTTTGTGTTG
CTAGAGCAGAGCCTGTGGTTGGAAATGTAGAAAGAATCCTGGAGAGAGAAGCAGGACCCA
GATCTTGCAGAATCCTCACCACCCTGCCACCATGCCAGTGCTATATAACGGTACTTAACT
TGGATATGGGATGGATTGGAGTGAGGAAGAGGGAATGGTTAGGAGATGTCACAGTTCAAG
TACAAAGCAATTGATTAGGTAACAGTGTAAGGTAAATATTATTAATAGACTTAAGGGATG
GTCAGGTGATGAGGAAGAGAAAGGAATCAACAGTGACTTCCAAGACTGTGCTTTCAGGGA
TCATGTCTATAGTTTGCCACTAGAGAAGTTTTTTTGAACATGTAGTAGGGCACCAGAAGC
ACAAGGAAGAGGCACAGCCTTCTCTCCTGAGCATGAATCTGGCTCTTGGTCTTGCTTTGT
TCCAGCTACCATTTGCCATTGATTATGTCCTTCTCTTCCTTCCAGAAAGTAAAAGGGAGA
GAATGCAGTCTGAGTGGTTTTTTTAATTAAAAAAAAAAAAAAGAAGGACTTCCAAGTTTC
TAATTTGGACATCAGGTCAGCTCATGTGCCATTGCTTGAGCTAGGGAAAGTAAGAGGAGA
AGAACATGTTGGGGGAAGATGTGGCTTCAGTTTTAGATGTGTTGTATTTATGATACCTGA
GACCCATGCACATGAAAAGGTTCAGAATGTGTTTGGAAGTGTATATATAAAGCTCAGGAG
AGAGCTAAAATAACATAAGGTTACATGGCCATCAGCGTATGATTATTGAAGCTGTGGGTG
TAGATGAGATCAAAGAGAGAGGATAGAGATAAAGTGGCAGGCAGAACCTGAAAGAACAGC
TAAAAGACTGTTTAGAAAAAGCAGACATTGAAGACACTGAGAAGATGTGGTCCTAGACAT
AGCGGGGTCACAAGAGACTGAGGATCTTAAAGGCAAAAATCCTTTAGTATCAAAATATTC
ACAGGTTGAAATGTTTCTGAGAGATCAAATAAGAGAGGGCCTAAAAAATATAAATTGGAA
AAAGCCAAAAAAGTGGTTTTTGGGATTTTGGAGAGAGAACTTTTTACGGAGTAGGAGGGC
AGAATTCTGAAGCCATTCTTTTTTAAGAGCAAATGGGAAATGTCGAAGAGGGAAATCAAT
TGTAGATAACTCTTTCAAGAAGTTGCAATTGGAGTGGAATGCAGGAAAAAAGAATTGGTT
TCTTTGTTTTCAGTGGCTTTCTCATGTTTAAATGTTGTAGGACTAAGGATTTGGAGACGT
TTACAATTTTAGACAGGGAAATCGATAATAATTGATATTTACAGGCCTTTATTTTTGCAG
AAATAATTTTTCTAGCATTGGAAGTGTTTAGATAAACCTGTGAGTTCAACGTTTAAGAAC
ACTTCGTATTGAATATTGTCTTTCCACTGGAAACATTAATTTTTCATGGACTGAAGCAAT
ATAGTTTTTATCAAACATATCCCCTTTTCGTAAAAATATAAAAGAAAAGAAAAAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved