Homo_sapiens Locus Mono:170:AC095349.10
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:170:AC095349.10
Homo_sapiens
Mono:170:AC095349.10
3
SNORD3@L12
1001..1211
2211
ATTTTTGTCAATATTCTCTTTGTTCTCCTTTTCTAATTTTCTCCCCACTCCAAAAAACT
GAATCAACAAATACACTCTGTGGTATTAAAAACTGTTGCAATCAAATCTTTTCCATTAAT
GTTTTAATAAAATATAATTTTGATTCTTGTGTAGCTATAAAAAGTAATGAAAACTTAAAA
TTCTGGCCTGCATAAGATTGCTGAGATTATTCAACTACATATACATATGGAAATTTATTA
TTTTAGAAAACTTAACATGCCAAATTAAAATATTGCAAAAAATGCTTGCTAATTATACCT
CTAAATGTGTTATTTAAATAGAAGTTAATAGTCCTAAAATGTTGGAGGACATACTTCATT
CATTACTAAATGTCAACAAATGACATAAAAATCTACTATCTTTAAGAAAGAATCAGGATT
AATCCAGAAATGTAAGAAAAGTATTAATTGCTATCCTTTAAATGAATGAGAAAAGACTTA
TGAAATTCTTCAGTTTAATGCTTTGGGACACTAGCACATTGAGTGACTTTATGCAGGATT
GCACCCTAAGCAAAACAGGACATATGCCTTTCTGAGGCATTTATACTCAAACATCAATTT
CAACTTTAAAATATAATTTATTGTATTAGTCTATTCTTATGCTGCTATAAGGACATACCT
GAGACTGGGTAATTTATATAGGAAAGAGGCTTAATTAACTCACAGTTCAGCATGGCTAGG
CAGGCCTCAGGAAACTTATAGTCATGGCAGAAGGGGAAGCCAACATATCCTTCTTCACAT
GGTGGCAGGGAGAAGAAGGAGAGCTGAGCAAAGGGGGAAGTTCCTTATAAAATCATCGGA
TCTTTTGAGAATTTACTGACTATCATGAGAACAGGATGGAGGAAACCAGCCCCATGATTC
AATTATCTCCACCCAGTCCCTCTCATGACATGTAGGAATTATGGGAACTACAATTCAAGA
TGAGATTTGGGTGGGGACACAGCCAAACCATATCATTTATCAAGACTATTCTTTCAGGGA
TCATTTTTATGCTTTGTACTAGAAGTTTCTCTGAAAGTGTAGAGCACCATCAACTATGGG
AAAGGGGCACAGCATTGTCTCCTAAGCATGAAGCCAGCTCTCTGTGTTGTGTTGCTGCAA
CTGACACTTGGTATTGATGATCATTCTTTCCCTCCCTCAAAAGAATAAGAGGGGAGGATG
AAGTCTGAGAGGTAATTATTTAAAATAACTAATTAATTTAATATAATGCAGTTTATCAGG
CAACAATATGTAGAGATTAAAATGCACGTTTGTTTCTATCATCTATAGAAGATACATCTT
CCACAGTTTTTTACAGAAGGCTGTCATTTCTCTAAGGATTCACAATCAATATTCTTTGGT
TTATACAGTGTATACATCCAGTAATCAGATACATTACTTGACATGTTTTTAAATGTTAAC
TTTCTTTGACATTTTAATATTTTAATCAGGAATTTCATTTCCCTAGATAAGATAGCTTTC
ATTATGAAATTGTGCTTTTTCAGTTCATTTGAAGGTGGCATTGTGTCTGAACTTTAGGAA
CAATGACTGAAGATAAAGATGTTAAAAAAACATCAAGATACAACAGAATATCATATAAAA
TTTTTATTAAGTTAAATGACATTAAATGAGAGTAGTAGTTTTAAAATATATCTACTAATT
CTTTGACATGCCTTCCTTTAAGAAACGGAGCTTCATCCCCCACCCCTTGAATGTTGGGTG
GATGTAGTGGCTTGCTTCTATCAAATAGACTATGTAGAAGTGATGGTGTGTGACCTTCAA
TATGAGGTCATGCAGGGCCTTGCATCTGTCTCTTCACTCTCTCTGGGATCACTTGCTCTG
GTGAAAGCTGGTAATAGATACCATGTCATCAGAATACTCAAGCAACTCCATGTAGAGGTC
CATGTGGACAGGAATGGATGCTTCTTTTCAAAAATCATCAAGGAATCAATGCCTTCTGCT
AGAGTCATGTAATTGAACCATCCAGTAAGTGGATCCTGTAGCTACAGCTCCAGTGAAGTT
TTTAAGATGACAGTAACTCCAGCCAACACCATGGCTTGACCCTCAGCCAGAACCATCCAG
CTAAGCTGCCTTCAAATTTTTGACTCATAGAAATATGAGACAATAATGTTTTATGTTTTA
AACTCCCAAGTATGTGGATAATTTGTTCTGCATCAATAAATAACTATTACAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved