Homo_sapiens Locus Mono:185:AC021876.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:185:AC021876.5
Homo_sapiens
Mono:185:AC021876.5
7
SNORD65L2
1001..1071
2071
GTGATTTCTGCATCAATAAAACTCAATGACCTCGGGCCAAGTGCAGTGGCTGACACCTA
TAATCCCAGCACTTTGGGAGGCTGAGGTGGGAGGACAGCTTGAGCCCAGGAATTTGAGAC
CAGCCTGGGCAATATGGCGAGACCCCATCTCTACCCCCACCCCCCCAAAAAAAGAAAAAA
ATTAACTGAAAAACCAACAGGCCAGGCACAGTGTTTCACGCATGTAATCCCAGCATTTTG
GGAGGCTGAGGCAGGTGAATCACTTGAGGTCAGGAGTTCGTGACCAGCCTGGCCAACATG
GTAAAACCCTGTCTTTACTAAAAATACAACAATTAGCTGGGCGTGGTGACAGGTGCCTGT
AATCCCAGCTACTCGGGAGGCTGAGGCAGGAGAACTGCTTGAACCTGGGAGGCAGAGGTT
GCAGTGAGCTGAGATCACATCACTGCACTCCAGCCTGGGCAACAGAGCGAGACTCCATCT
CAAAAAAAGAAGAAAATAACAAAAATACAAACCTCAATGACCCGAGACAACAAATTTATA
TCCTATTTTCTTATACCCATCCCCCTACCCCACCCCTACACAAAAAAATCCAGTGAGTTT
TTTTTTTTTTTTTTAACCCAATAACCCATTACAGAGTTGAAAAAATTCCCAACCAATACA
CTTTCAGTGAGTGAATACTGACCAGCAAGTCCACACCAGCCATTGTTCTGGGTCTTTGAT
AACATGGGAGGACAGAGCCCTACCCACCTTAGCTCTGGTGGGAGAAACAGACACAAGTCA
TAAGACAATTAAATATAAAGTGCTGGCTTGGGGGTAGGGGGCAGGGAGGGGTGCACACCT
ATAGCCCCAGCACTTTGGGAGGCAAAGGAGGGAGGATCACTTTAGCCTAGGAGTTTGATG
CAGCAGTCAGCTATGATCTCACCACTGCACTGGGCAACAGAGAAGACTCTGACTTCTGAA
ATATGTACTTACACACACACACACACACACAATGCTAAGTCAAATAATGAAATCACCCAA
AATAGCTGGAATTACTGGCAGATTGTGTAGCAATAAACCTAGTTTTCTGAAGAAAAAAAA
AATACATGAGATAATGCAAGCCTACATGTTAAGTGCTACCATAGTGTTAAGTATGGGAGA
AATACAGGAGAGATGTCTAATCCAAGCGTGGTAGGAATGATGTCTAAATTGAGGGCTAAA
TAATTGGTGAGAATAAAGAAAGATGGAAAGGATCCAGAACAAAATAAGACTGTTGGGGGG
GAAAAAAAAGAGCAAATGGATTCTTGGCAAAGAAAATGTATGCAAAAAGTCCTGAAGCTA
AGAGAAGGATGGGGTTGAGGAAGTAAAGTACTTCACAGTACTGGAGCACACAGCATGTGA
ATTTCAGCCAAAGGACAAATGCCTCCAAAAAAAGTTAATTCACAGTGCAGCAGGGCGAGG
CACTTGTCTTATTCGCTGGTTCTCACATTGACCCTGAAAGGACTTTTTTTTGTTAATCCC
ATTTTCACAGATGGGAAAGGGACTCTGTATGGTTGTCACTTTTATCCAAAGTCTCATAGC
CAGTAAGAAGCTGCCCTCAAAGTCCCTACCCTGTCTTCCATTCGACTATTCTGAGGTTCA
GACCCAGAAACCCCATACCTCTGCCTTATATTTTAATGAAAAGTATGTCTCCAGGTTTAT
GTGGAGAATAACCAAGACCTCAGAAACATTTAGTGAAAATCAGAGCTAGAAGGAATCTGT
TTTTTTGCGAGTTCAGAGAAGCTGACTTGGATAAGACATCAAAGTTGTCTTGTGCAGCAA
ATTCTCCTCCGGCACATAGTAGGCACTCTGATAAATTCAAAAAGGCTTCTAAGAAGAGGC
AGAAGCAAGGACAGGGAAGGAGCTCAGCTCCACAGCTCAGGGAGGGTGACAGAATGGCCT
AAGGCCCAGGAGAGCACCGTGTTGTCAACTGTCAGTGTCAAGCCTGAGACAGGAGCCATG
AACTAGCACCATCTCAGCTCTGATGTTGAACTGCAGCCGTCTCCTCTAAGGTCTCAAACT
GGCCTTATACCAACACATGCCTCCTTCTATCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved