Homo_sapiens Locus Mono:127:AC010273.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:127:AC010273.8
Homo_sapiens
Mono:127:AC010273.8
5
SNORA76
1001..1132
2132
CTAGTTTACTTAATTTTTTTTTTTTTTTTTAAGATGGAGTCTAAGGCCGGGCGCGGTGG
CTCACAGCTGTAATACCAGCGCTTTGGGAGGCTGAGGCGGGCAGATCACAAGGTCAGGAG
TTCGACACCAGCCTCGTCAACATAGTGAAACCCTATCTCTACTAAAAATACAAAAAAATT
AGCTGGGTGTGGTGGTGGGCGCCTGTAATCCCAGCTACTCGGGAGGCTGAGGCAAGAGAA
TCGCTTGAACCCAGGAGTCGGAGGTTGCAGTGAGCCGAGATCACACTATTGCACTCCACT
CTGGGCGACAGAACAGGACTCCGTCTCAAAAAAAAAAAAAATCGAGATTGAGTCTAGCTA
TCGCACCCAGGCTGGAGTGTAGTGGCACCATCTCAACTCACTGCAACCTCTGCCTCCCGG
GTTCAAGCAATTCTCCCTGCCTCAGCCTCCCTAGTAGCTGGGATTACAGGCGCCCGCCAC
CAAGCCCGGCTAATTTTTGTATTTTTTAGTAGAGATGGGGTTTCGCCATGTTGGCCAGGC
TGGTCTTGAACTCCTGACCTCAGGAGATCCGCACGCCTCGGCCTCCTAAAGTGCTGGGAT
TACAGGCGTGAACCACTGCGCCCAGACGAGTTTCCTTAATTTATACCACAAAGTATATTA
TGATATCAATTCACAAGGTTATTTAATCATAAAAACAAAAATTTTTCTTAAAACCAATTG
AGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCGAGGGGGGTGGATCACTTTGAGGT
CAGGAGATCGAGACCAGCCTAGCCAACATAGCGAAACCTCGTCTCTACTAAAAATTAGCC
GGGCATGGTGTATGTGACTATAATCCCAGCTACTCTGGAGGCTGAGACAGGAGAATCGCT
TGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCATGCCACTTCACTCCTGCCTGGG
CGACAGAGTGAAACTCCGTGCAGGAAAAAAAAAAAAAAAAAGCGCTGCCTTTGTACCCCA
CCGTGCCTCCGCCTGGTGTCTGGGGTCAGGTTGCAGTGCCAGAGCACGTGCTTGCGCATA
AATGGGGCAGCCTGGCCCCCTGCGGATGGTCCTTTTAACCGCGAGCAACAAGGAGGCGAA
AAAAAAATTGATAGTTAATGTGTCCGCCTTTTTTTTTTTTTTTTTTTTGAGACTGAGCCT
GGCTCTGTCGCCCAGGCTGGAGTGCAGTGGCACTATCTCCACTCACTGGACAACCTCTGC
CTCCCAGGTTCAAGCAATTCTCCTGCCTCAGCTTCCCAAGTAGCTGGAACTACAGGCGTG
CACTAGAATGCCCGGCTAATTTTTTTGTATTTTTAGTAGACAGGGGTCTTGCCATGTTGG
CCAGGCTGGTTTCGAACTGCTGACCTCAGGTGATCCGCCCACCTCAGCCTCCCAAAGTGC
TGGGATTGCAGGCCTGAGCCACCACACCTGGCCTATAGTTAATGTGTCAACTTTTATAAA
TGAATATAAATATGTCTCTCAAACTTAAAGTATATTTTCACTAAAAAAATAGCAAAATAG
AGCTGGGTGTGATGGCTCATGCCTGTAATCCCCGGCACTTTGGTAGGCCAAAATGGGAGG
ATCACTTGAGGCCAGTTCAAGACCAGCCTGGTCAATATAGTGAGCCCCTATCTCCATTAA
AAAAAACAAATTAAATAAATAAAAGAGAAAAGCAAAATAGAGCTCTTGAATTGTCCATTT
AAAAAAATATTCCGGGTTTGGCAGATAAAATAGCTCTGACAAAAGTTTTGGATTAGTTAA
AATCTAGAAAATGCCAAGCAAATCTAATTATTGTCATTATCTCTTATAAGATGAAGTAGT
AAATTTTTGTAGTTTCCTTGAAATACAATGGAAACCCAGGAAACGCCTAAGGCATTTAAA
GGGTGTAAAAGTCATCTTAATTATTTCATAATTCCAAATATACAGCCTGAATTTGAAGAA
AGGAATATCAAAAAGACTTGTCAGAACAGAAATTCACAATAGGAAAGACTTGGAACCAAG
CCAAATGTCCATCAGTGATAGCCTGGATTAAGAAAATGTGGCACCGGGCATGGTGGCTCA
CGCCTGTAAACCCAGCACTTTGGGAGGCCGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved