Homo_sapiens Locus Mono:217:AC092807.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:217:AC092807.2
Homo_sapiens
Mono:217:AC092807.2
1
SNORD81L3
1001..1077
2077
GATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGACCAACATGGTGACACCCTGTCTCT
ACTAAAAATACAAAAATTAGCCAGGCGGGATTGCTTATGCCTGTAGCCCCAGGTACTCGA
GAGGCTGAGACAGGAGAATTGCTTGAATCTGGGAGGTGAAGGTTGCAGTGAGCCGAGATC
ACATCAGTGCACTGCAGCCTGGGTAACAGAGTGAGATTCCATCTCAAATAAATAAATAAA
TAAATAAATAAATAAATAAATAATAATAATAATAATAACTACAACAACTTTTCAAGACAC
AGTACAATAAAATATAAATGGAAACAACAAAAAGCCTTGAAGTTGAAGTGTAGCGTTTTT
ATTAGTTTTATTTTTGCTTGTTTGTTTATATAAGCAGTGCTAAGTTGTTATCAGCTTAAA
ATAATGGGTTATAGGATAGTATTTGCAGACCTCATGGTAATCGGAGGTCAAAAAACATGT
AATAGATACACATAGAATAAGAAGCAAGAAATTAAATCATACCATCAGACAAAATTATCT
TCACTAAAAGGAAAGAAGGAATAGAAGATGACAAAACAACCAAAAAACAAATTACAAAAT
AGCAAGAGTAAGGGCTTACTTATCAATAATAACAGTGAATATAAATGGACTAAATTATTC
AATAAAAAGACATAAAGTGACTAAATGAATAAAAAAAACCAAGACCCAAGGAGCTGTTGC
CTACAAGAAACACACTTCACCTATAAAGACACAAGTAGACTGAAAATAAAGGAATGGAAA
AAGTTATTTGATGCCAATGGAAACCAAAAAAGAATACCTATACTTATATCAGACAAAATA
GATTTCAAGACAAAAACTATAAGAAGAGACAAAGAAGGTCATTCAATAATAATAAAGGGG
TCAATTCAGCAAGAGAATATATTATAACAATTGTCAACATATATGCACCCAACACTGGAC
CACCCAGATATATAAAGCCAATATTATTAGGGCTAAAGAATGAAAATACATGATGATCTC
ACTCCAACTGGAACTCTCTCACTGATTACTTGATAACAATAAAATATCTGATATTCTGCA
AAAAACAAACAAACAAAAAACAAAAACAAAACAAACAAAAAAAGAATGAAATAGATCTTA
ATACAATAAATGTTAGAGACTTCAACACTCCACTTTCAGCATTGAACAGATCTCCCAGAG
ACAAAATCAACAAAGAAACATTGGACTTTCTCCACTACAGACCAAATGGACCTAATAAAT
ATTTATACCCCAAAGAAAGGAAATCATATATTCATTTCCATGTTTATTACAGCACTGTTC
ATAATAGCCAAGATTTGGAAGCAACCTAAGTGTCCATCAACAGATGAATGTATCAAGGAA
AAAAGTGGTACATATACACAATGAAGTTCTATTCAGTCATAAGAAAGAATGAGATTCTGT
CATTTGCAACAACATGGATGGAACGGAAGGTTATTATGTTAAGCAAAATAAGCCAGGCAC
AGGAAGTCAAACTTTGCATGTTCTTGCTTATTTCTGGAAGCTAAAATTTAAAGCAATTGA
ACTCATGGAGATAGAGAGTAGAAGGATGGTTACCAGAGTTTGGAAAGGGTATTGGAGGGT
TGAGGAGGAAGTGGGGATGGTTAACAGGTACAAAAAAATAGAACAAATAAGACCTAGTAT
TTGCTAGCACAACAGGGTGACTATAGTAAAAAATAATTTAATTATACATTTTAAAATAAC
TAAGAGTATAATTGGATTATTTGTAACACAAAGGATAAATGCTTGAGGTAATGAATACTT
AATTTACCCTGATATGATTATTATGCATTGCATGCCTGTATCAAAATATCTCTTGTAGTC
CATAAATATATATACCTTCCATGTACCCACAAAAATTGAAAATAAATTTAAAAAGTTTTA
TGTTCCTCGTAGCACTTAGCACTATCTGATATTTTCTTGTTTATTTATTACATCTCTCCC
TTCAAGAATGGGAGCAGAAGTTTCCCTGGACAACATGGTGAAACCCTGTCCCTACTAAAA
ATACAAAAATTAGCTGAGTATGGTGGCACGTGCCTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved