Homo_sapiens Locus Mono:186:AC004129.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:186:AC004129.2
Homo_sapiens
Mono:186:AC004129.2
7
SNORD3L4
1001..1226
2226
CATGACATATTTTACATCACCAGTCATGTTTTCCTGGAAACTGATTTAACTTTTAACAC
TTCAGAAAATATCTGCTGTAAAATACTAAATAGCCAGAGAGAAAGACTGTATTTCCCATC
TTTCAACACCATCAATGTTACAAAATGCCTTTCCCCACTGACTAGTGTAGGTTGTTCCCC
GCATCGTAATCTCACCACAGTTCATTCAGTCACTTGCTCCTTCATTCATTCACACGCGTT
TAAGCCCTAGGCTCTTTGGAACATACTAAGTGTGCAGTGATGAGTAAGACCCTGTCCTTG
CTCTCAAGAAGCTCTCAGCCTAGTCAAAGCCAGATGAACAAAAACTGAATTCCAATGCAA
TGGGGCAGATGCATCTAGGACATCAAACAGGTGCTCAGAGGAGACAAGGTGGTAGGGTGG
GCTGTGGGGCAGGCCAGGTTTCCATGGGGAGGCAGCCACTGAGGTGAATCCTGTAGAATG
ATTCACGTAGGTAGAAACATAGAGGAAGTGTGTTCCAGGAAAAGAAATATTTCAGGAAGT
GTATCCCAGGAAAAGAAATATTTCAGGAAGTGTATCCCAGGAAAAAGCATGTTGGATGGA
ACAGGGCTGAACTGTCATGTTGGGTTTGAGAAGGAGTAATGAGGCATAGTAGCACATAAG
GTATAGGGCAGGGGAGAAATGGGAGCAGCAGGACATCATCCTGGGATGGTAGGCAGAGGC
CAGATCATGCAAGGTTTTTAAAATTATGATAAGAGTTTATATTTTATCCAGAAGAAGGGG
GGGGAATTAAAGGGTTTAAATAGGAGTCTGTTGTGATTAAATTTGGATTTTAGGAAGATC
ACCCTGAGATTGGTGGAAATATTGCCTGGAAGGGAGTGAGACTGAGGCAGGAAGACCAGC
TGAGAGACAATGGCAGTCGTCTGGGCCTGGGACAACCAGGGATTGGACCAGGGCAGTCAA
GGTGGGCTTGGAGGCCAGGGAGCAGAATTAAAATACACTGAGAGATTATACTTTCAGGGA
TCAATTCTATAGTTTGTTACTAGGGAAGTTTCTCTGAATGCGTACAGACCTGCAGAAGAG
CAGCAGAACCCATGAGGAGAAGGCGCAGGATGATCCTGAGCATGAAGCTGGCTCATGGAG
TTGCTTTGCTGCTACTGTCACTTGCCATTGATGATCGTTCTTCTCTTCCTTTGGGAGAGG
AAGAGGGGGAGAAAGCAGTTGGAGTGGTTCCAGTTAAAAAAAGAAGGAAAAAGGAAAAAT
AAATAAAATACGTTGAAAGTTATCAGAAAATGGCAAAGATTTAGAGTAAATGCTTGGCTT
TAGTTTTGGGAGGTGCAGAATACAGAAAAGCCACTAAACCAGGCAAGGGGATATTGGCTT
AGTAATCATTTTGGAGATATTACGTCAGAGATATTACTTCAAATATTATTACTTTTGAAG
TTTTATATCTGTCTAGTTGGAATTGAAGGAGGGACACCCTGGTATCGAGGTCTAGTAAGT
GGCTGAAATATGAATCTGGAGCTCAGAAGAGAAGCCTGAGCTAAAGACATAGATTTGGCA
GTTGTTTGTCATTGAAAGTAGAGCTAACCTGTAAGGGTGCAGGAAGATATTTACGGAAGA
CACACAGAATGAAAAGAGAAAATGGCCAAGAACGAAGCTCTTGAGTGCATACCCACTTAA
AAAAATTTTTTAAGGTAAAATATTCTTATTATAAAAGTAATACAAATGAAAACAAATATT
GAGAAAAGACAAAGTTATCTATTTACTGTCCTGCCATCCTACTGCAACCACAGTTAGTAA
TTTGATTTCCTTTGTCATCTTTTTATCGTATGATGGGTGTGTTATTTCAATCATGATTAC
AGCCATTCATACGCTTTTGTATCTTGCAATTTTTATTTAATATAACATTTTCTCATGTTT
TAAATAATATTGATTACTAATTTTCAAAGAGTACTTAATGTACCACTCATATATATCCTT
TTATTGACTAGTTCCTGGACGAGGGGATGGCAAACTATGGGACCACATTTATAGATAGTT
TTATTGGGACACAGCCATGCCCATATTGCTTACATATTTTCTGTGGCTGCTTTGTGTTAC
ATACAGCAGTGTTGGCAACTTATGACTGAGAGAGTATGGCCTGCAAATCCTAAAATATTT
ATTTTCTGATCTTTTATAGAAAAAGTTTGCTGATTCCTGACCTAAATTTTTAGGTGGTTT
GTAATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved