Homo_sapiens Locus Mono:5:AC124254.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:5:AC124254.5
Homo_sapiens
Mono:5:AC124254.5
18
SNORA25L10
1001..1127
2127
TAGTTTGGGAGTCAGATTGCCATGATTAAAGTATTATTTATCCTTGTGTAATAATAATT
TTTAACTTTAACAACTGTCTCTTTTTAATCTATAATAAACTAGTTTTATGGAAGATAGAA
TTTCTTGCTATATAAAGAATACAGGGACTCATTGTACTAGAGAATCAAGTCAGCCGGCTA
AATTATCCTACCATTATATCCTTAAACCTAATTTTGGAAAAGAGAAAGTTAATCAGTGTA
TTCACCTTACATGGTGGCAAGAACTATGTTAGGCCTGATTCATGTAAAGAAGATGTTGCA
AAGAATTTATTTCATAAATCTTAAAGGAGATATGATTACAGGTTTTTATCTGTTCTTGAT
TTTTTCTCCTGAACACTTACGCATTAGCAAGTGATCAGCATGCGGGTTTGACGCCTAATT
GTTGGTAAATGGTTGAGGCACGACAAAAATATTAATATCCATTGTTTACCATCATGTTAT
TTGAAACAGAAGTGGCATGTGTACTCTCTTGCTTGAAGAAGTCTTTGACAAAAAAAAAAT
CATGTCATTTATAAATTTTCTTGTTCTAAAGAAATCAGTTATGTTATATATATGTATACA
TATAAATTATGTAAATAAAAGTTATTTTATACCAAAAAAAGGATAAAGTAATCAAGAAAA
CGTAAGAATCTTAAATGAGCATACACCTAACAGAGCTCCAACATACACGAAGGAAAAACT
ATTAGAACTAAAAGTTAAAAAAAACCCAGAAAACACATTTTTAAATCCCCGAGTACCTGG
AAATCAAAAGCACACTTCTAAATAACCAAGGGACCAAAGAACAGATTGACAGAAATTTTT
GAAAAATATTTTTTAAACTGAATGAAATGCTGAAATAACATATGAAAATCCTTGCTAAAA
TAGCGCTTACAGGGAAACTTGAGCATTAAATATTTAATTAGAAAATTAAAAGATCTAAAC
TCAATCACAGAGTTTCCACTTTAAGAAACTAGAAAAAATAAAGGACATTTCAATGCGGGC
TCATGGGGCTGTGAAGCCAAGAGCTATTAACACTATGACCAAGGATTGAAATTCTCTATA
GGATCCGTAGCACTGAATAGTGCTATATTTTCCGGAGGAAGTATAAGACTTAGCCATTTA
TAATTATGACTTGATAATCCATAATTGTTGATGTGGGAAAGTAAATACATTTCTCAAAGT
TTAAGTAGATTTTCTTTTTTTTAAAGGAAAAAAAACAGACCCACAGTAAGCAGAAGAGTT
AAATAATAAAGATAAGAACCGAAATCAATAAAATTTGAAACAGAAAAACAATGGGAAAAA
AATTGATGAAACCAAAAGCTGGTTCTTTAAAAAGACCAAGAAGAGGCAGTGACCTAGCAG
AAAAGATAGATACATTGCAAAGAAATCTCTGAACAAACATACCCAATAAAAATCAAAACA
AGCCAGGCAGAGAAAACAAATAAATAGCTAAGTTTTCAACGCAAAGACAGATGTACATCC
ACAGGAAACAATAGCAAACAGGAAACCAGGACCTCCCCAAACAGACAGATCAAGTTGCCA
GTGACTGACCCTAACTAGACGGGAGTAGATGAGCTCTCTGATCAAGAATTCAAAATAGCA
GTTTTAAGAAAACTCAGTGATCTTCGAAATAACATGGAAAAGCAACTCAGAAATGTATTA
GGTAAATATAATAAAGAGATTGAAATTTTTTTCACTTTTTTTATACTTTAAGTTCTGCGA
TAGATGTGCAGAATGTGCAGGTTTGTTGTATAGGTACACAGGTGCCATTGCGGTTTGCTG
TACCCACCAACCCGTCACCTACATTAGGTATTTCTCCTAATGCTATCCCTCCCCTAGCCC
CCCAACCCCTCGAAAGGCCCCGGTGTGTGATGTTCCCCTCCCTGTGTCCATGTGTTCTTA
TTGTTCAAATCCCACTTATGAGTGAGAACATACAGTGTTTGGTTTTCTGTTCCTGTGTTA
GTTTGCTGAGAATGACGGTTTCCAGCTTCATCCAAGTCCCTGCAAAGGACATGAACTCAT
TCTTTTTTATGGCTGCATGGTATTCCATGGTGTATATGTGCCACATTTTCTTTATCCAGT
CTATCATTGATGGGCATTTGGGTTGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved