Homo_sapiens Locus Mono:293:AC107376.7
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:293:AC107376.7
Homo_sapiens
Mono:293:AC107376.7
8
SNORA45L4
1001..1111
2111
ATTACATACACACACAAAAATATCAACAGAGCAAACAAAACTTAAGATTCTAAGAAGGC
TGGGGAGTTGAGCCACTGGTGTGTCCGTGCTTCTCTATCTCCTCTTCCTGTGTACAGATT
AGGATGTGACAGAGTCTTAATTTAAAGTTTGAAACTATAATCCTAATTTCCATGAGAATT
TGTAGTAGTAGGGAACCTGAGCTCAGCAAAGGAGGCTGCGGACGAGCCTCCAGTCTTTGG
TGAGCCTCTTGTCTTCCTGTGGACTTCACCTCCTCACCTGCCTTTGCTATCCTGGGTTAC
CATGTTTAGACTCAACTCTAGCTCAGCACCCTCTGGTCTTGGGTAGGTATCAAAAATTAA
ATCTTTTTGTCTAGCCTTGGTTTCACACCCCCTCCCTTATATCTTTCCTATAACATCCAA
TAAGAGGATATCCTGCTTTCCTCCTTAGCCCAGATCGACTCGCCATGGGCACCACCATGT
CTAAATGTCAGCAGGGCACTTCCAGCCTTCCTCAGTTTGTAACGGACCATTATAGTGCAT
GGTCTTTTAAATCTGCAATAGGCGCACCAGGGGTGACCCCAAATTTTAATTTCGCCTTTA
TGGGTCCTGGAACTATGGTATCCTGCAGCATTTAAAGGAGGACCAGGGAAGTCACCATGC
CAACTAGATTGTTTCATGTATACATGGAAAGATTAGGTTCTGACACAAGTTGCCAAGAAA
GTAACCAAAACCTCACTAAAGATGTTGAGAGAACCACTGGGAAGTCCTGTCAATTTCCTG
TTCAAGTGTGACCCACTAAGACCACACCCCGCCTCCCATCTCACAACAGCTAAAGACCGA
ATAATTGACTTCCTCCTCCTTCTCTGCCCCCAGAGTCACCCAAAATCGTCTTGAGTAGAG
TTCCAACAAGTGTCCTGATGTTCCATTTTCAAAGATGCCAACCGGAGATGCCCAGAGCTT
TGCTATAAAGTGCCTCTTAATCGCATATAAAATTCAGCCTCACCAAGATTCAAGTCACAT
TCCGAGTGTCCCGGTGTGCTAGGGCACTTGCAGAGAATCTGCTGGTCTTGATTCACTGGT
GGGGGCAATCGGTGCCCAGATTAGGAACATGCCCTGCCTGGGGTTTTAGACAGCGGGCTG
GCAGTCATCTTTCCTCACACCTATCAGGCAGATGGTACCTGCCATGGTGTATTGTAAAGT
ATTAAAAAAATAAAAAAATTAAAAAGAACAAAGAAAAATTCAGCCTCAAACCATTAGCAC
TGCAATCCTCAAGCCATTAAGAAGGCACATCCTAGAAATAATTAGAATATTTTCCATCTA
GAAAAGGCAGAATATGGCTGGGCATTGTGGCTCACACCTATAATCCCAGTATTTTGGAAA
GCCAAGGCAGGTGGATCACTTGAGGTCAGGAGTTCGAGACCAGCCTGATTAACATGGTGA
AACCCCATCTCTACTAAAAATACAAAATTAGCTGAGCATGGTGGTGCACACTTGTAATCC
CAGCTACTTGGAAGGCTGAGGCAGGAGAATTGCTTGAATCCAGGAGGCGGAGGTTGTAGT
GAGCCGAGATCATGCCATTGCATTCCAACCTAGGCAACAAGAGTGAAACTCCGCCTAAAG
AAAAAAAAAAAAGAAAGAAAGAAAAGGCAGAATATTTGAATATTTCAGAATGGCTGAAAA
TAAAGTTAAGTCTCTTTTCAGATAAGTCTAGGCTGCAGAAGGCCAGGAGAGAAAGCAATT
GTTTGTATTTCAAAAAAAAATCTTGGTCGACTAAGAGGCATTAAGAAGATACATTCTATA
TACATAAAGAGAAACTAGAGAAAAAGGAAAATTAAAGATCTGGGGACTAGGTTATGATAA
AATCAGCTTAGAGAATCACTTGGATTTATGCATTGTAAACTTTGGTATAATATAATAATA
TGTTGGTAGGAAATGTTATATATTATAAAAGGAAGCTCAAAGAAGAGAGAGAATAAATTT
TAAAGGCTTTAATATCATTACTATTTACTAAATTAAATTGTAATGAAATACATGAAGCTG
TGTGGGTTCTAACATTGCCAGAAATTGAATAGTAGAAGATAGAATTGGGTGCCATCCAGA
ACTTGTGCATAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved