Homo_sapiens Locus Mono:228:AL512326.25
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:228:AL512326.25
Homo_sapiens
Mono:228:AL512326.25
1
SNORA67L3
1001..1137
2137
TCCTCAGAAAAATTAAACATAGAATTACTGTATGATCCAACAATTTCACTTCTGTATAT
ATATATTCAAAAGAATTGAAAGCAGGAACTCAGATATACTTGCATGCCCATGTTCACTGC
AGCATTAGTCACAATAGCCAAAAAGTGGAAGCAATCAAAGTAGTCCATAAAGAGATGAGT
GGATAAAGAAAATGGGCTACATACACACCATTAAATATCATTCAGCCCTTAAATAAAAAA
AAAGAAATTCTCCTGCACGTTACAACACAGATGTACCTTGAAGATTAAGTTAAATGAAAT
GAGCCAGTTACAAAAGGGCAAATACTATATGATTCCATTTATATGAGGAACCTAGAGTAG
TCAAACTCATAAAGGCAGAAAGTAAAATGTGGTTGCCAAGGGCTAGAGGAAATTATAAAA
CGGGGAATTATAATTTAACAGATGCAGAGCTTCAGTCTGGAAGAAGAAAAGAGTTCTGGA
GATGGATGGTGGTCATGTATGGTTATATGGTAGTGATGGATGGTTACACAACAGTATGAA
AAGAGCAATGGCTCACGCTTGTAATCCTAGCACTTTGGCAGGCCGAGGTGGACGGATCAC
TTGAGGCCAGGAGTTCCTCCCCAAATCCAAGTTCCTAGATGCCAGCCAAGGGCCAACCTT
GCAAGCAGACCTCGCTAAGCATATCAGTCTCAATCAGGCCTGCTATGTTAATTCTTTCTG
CACAACTGAGATGTTCTCTTTGGAAATAACATGGTTTTTTGTCTTGTTTTTGGAGTTCTG
TGTTTTTCTATTCAAAATGCACCCCCATTTCCTGTCACTTTAACTAAAATTACCTTATTG
AAATTTGTATCTTTTTTGTAACTTATCAGCTACTTATGCCCAAGTTTTAAAACATTTACA
AGCCACAAATATGGTGGATACACTATGGGATGATTAAATTATTTGTCTGTACTTAAGTAG
AATACCTATGAGAAAAATCCCTTTAAGATTTAAAGATGGTAATCCAAGGTGATTCCTTCT
CCAAGGGGGACATCCAGTGACCCTCTCAGGAAGTAGCAACTTGGAATAGAATAGTCCAGG
AGTTCCAGGACCAGCCTGGCCAATATGGCGAAACCCCATCTATACTAGAAATACAAAAAC
TAGCCGGGTGTGGTGGCAGGTGCCTGTAATCCCAGCTACTCGGGAGGCTGAGGCAGGAGA
ATCGCTTGAACCCAGGAGGTAGAGGTTGCAGTGAGCCAAGATCAGCACCACTGCACTCCA
GCCTGGGCAACAAGAGTGAAACTCAGTCTTAAAAAACAAACAAACAAAAAAAAACAAAAA
AAAAAACCCCACTGACCTGTACATTTTCAAATGGTTAAAATGGTAAATTTTATGTTACAT
GTATTTTACCACAATTTTTTTATAAGACCAGATTTTAAAGAGAATCAAACAGAACCTGCA
GAAATAAAAGACATAATAATTGAAATTAGTTCAATGGATGAATCAAATAGCAGATTAGCT
CAGCTAAAGATGACTGTGAATACACAAAATGTAGCATGGTGATACAAAAATTGAATATAT
CAAACAGAAGTTATGCAACATGAGGACAGAATAGAATGTCCAACATATCTAAATACCATT
CAAGAGGGAAAGAAAAGAAAAATGAGAACGAGGCAATATTTGAAGATATAATTGCTGAGA
CTTTTCCAAAAACTGCTGTAGTTTCTGGAAGCACAAAAAATTGCTAGTAGGATAATAAGA
AATCTATACCTAGTCACTTTCCAGTGAAAATGCAAGACACTAAAGACAAAAAAAAAAATT
TAACCACCAGATAGAAATGACAGATTGTCTACAGAAAGGACAATTATACTGACAGTTTCT
CAATAGCAACAATGGCACCCAAGGGATAATAAAAAATATATATTGAAAAAGCTAAAGAGC
AAATCAAATACTCTTCAAGGCTGTACAACTAAACCTGCTATGACTTTGAGGGCCCTTTTA
CCCCCACCAAAAGACTATAAACTCAATTCACCAATACATTATAGTTAACTAATTCTTAAC
CAGGGAGGGTGTCTGATTTTCTTCCAGAATACACCTGCTTGGTTCAAAAAAAAAAAAAAA
AAATTAAAAAAAAAAGGCCGGGTGAGGTGGCTCACGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved