Homo_sapiens Locus Mono:113:AC118141.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:113:AC118141.4
Homo_sapiens
Mono:113:AC118141.4
4
SNORA75L2
1001..1127
2127
TTATAGTCTTCTGATTTATTGACACATAAAATTTCACTCTTTAGCAATTTTTTTTGTTT
TAAAATCAATTGTGTCTGATATTACTATAGCCACTGTAGCTTTCTTGGGGTTGCTCTTTG
CATGATATCTTTTCCATCCTTTTACTTTCAATATATTTGTATCTTTGAATCTAAAATGTG
TCTCCTGCAGAGAACATGAAGTTGGATCTTATTCTTTAAAACCCAGTCTGACAATCTATG
TGTTTTGATAGGATTATTTAATCCATTTACATTTAATGTTATTATTGCTACAGTTGGGTT
TACATCTGTCATTTTAACTTTTGTTTTCTGCTTTGTACTGTTTTTGCTCCTCTATTTCAC
CTTTACTATGTTCTTTGCATTAAATGAATATTTTCTTATGTAGCATACTATTTTTAAATG
ATTTTTTACTACACAGATTGAGTTATTTCCCTAGTGCTTGTTCCATATATATCTCAATTT
ATTTGAATTAGCTTCAGATTTACACTAACTTAATTTCAATATGATACAGAAATGTTATTC
TTGTAGCACCATTGTCTTTCTTCTTTTATAATACTATTATTATACATATTTCACTCTATA
AATGTCTCAAGCTCAACATTTCATGATTATAATTATTACTCAATATAATTTAAGCATTTT
AAAGAAGCCATTAAAGGAGAGGAGAACAAGTATATATTTATAGCTTTTGTTATACTAGCC
TTTTTATTTATCATTTCTGGATCTATTTGTTTTTGTAGATTTGAGTTACCATATGGAGTC
ACTTTCATAGCCTAATTGAGCTGTGTTTCCACCCACTTTTTTTGTGCTGTTATTGGCAAA
TGTATTACATTTCTATATTCATGGTATACATTTTATTTTGTTTCATCCAGTTGCCTTTTA
AATCAGTCAAGAGAAGAAATATGTGTTTATACTCTTGTGATCACATAATTACATTTTCAG
GTACTCTTTGTTTATCTGTGTGGATTCAAAAAATGAGGTCAGACTTCTCACTGAGCTTCT
TTCTGTCTGTTGCTGGCAGCTTATGGATTCATATGAGCAGAGAGAATCACAGAACTAGCA
TTACTTTTGTCTTTACAGGAGTATATTTGGCTGTCTTGTGAGATATTACGGTAAAAAAAA
ATTAGAAATCAAAGAAAAGAAAAATGAGGTCACTTGCTTTTAGCCTAAAAAATTTTCCTA
AGTATTTCTTGTAAGGTAGGTCTACTAACAACAAATCAGTTCACTTTTTGTTTATCTTTT
AATGTCATTTTCCTATTTCAATTTTGATAGTTTTGCTGTACATAGGATTCTTGGTTGAAA
GGTTTTTTTTTTCCTTTGAGTGCTTTGATTGTGTTATCCATCCTGTCTTTACCTCCCTTC
CCATCTGTGGACTCCATTGTTTCTGATGAGAATTTAACTTTAATCTTCTTGAAGTTCCCT
TGTAAATAATGAGTCACTTTTCTCTTGGTGCTTTCAAGATTTTTGTCCTTGCCTTTGGCT
TTCAGCATTTTCACAATGACTTGTCTGTGAATCTCTTTACATTCATCCTACTTGAAATTT
GTTGAGCTTCCTAGATGCATAAATTAATGTTTTCCAATACATTTGGTAATATTTTAGCTA
TTGTTTCTTCAAATACTCTTTTTGTTCCTTTCTTTCTGTTTTTCAGATTGCATAATTTTT
ATCAATTTTTTATATTACTAATTCTTTCTTCTGCTTGTTCAAATATACTGTTGAGCCTCT
CTAGTGAATTTTTTACTTCAGTAATTAAGTTTTCAAATCCAGAATTACCATTTGTTTCTT
TTTTTAAAAAAAATCTGTCTCTATATTCTCTATTTCTTGCATCATTATCATTACACCTTC
CTTTACTTATTTTATCATAGTTTTCTTTGAAGATATTTATAATGGCTATTTAGAAATCTT
TGTCAAACCTGATATCTGCTCATTTACACAGGTAGTTTATAGTATGTGAGGTGTTTTTCC
AGCATATGAATCATATGTTCTTTTTCTTTGTAGGTCTTGTAACTTTTGTTGCAAAGAACA
TTATAGATAATATAGCAATTCTGGGTATTTGTTCCTCCCCTCCAGGGCTTGAAATTGTTA
TTGATTTTTATTTGTTTAGTGACTGACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved