Homo_sapiens Locus Mono:108:AC104066.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:108:AC104066.3
Homo_sapiens
Mono:108:AC104066.3
4
SNORA26L2
1001..1123
2123
GAGAATCGCTTGAACCCAGGAGGTGGAGATTCCAGTGACCCAAGATCACGCCACTGCAC
TCCAGGCTGGGTGACAGAGTGAGACTCTGTCTAAAAAACAAAACCAAAAACAAACAAACA
AAAAACCTTTCCAGCTGAGGAGAGACTACCTTTCTTAGGGACTAGCCAATTCTCAGAGAT
AACAAGGGGCCAACCAGGAGCATGTCTTTGATATACAAACTAATCAATCCAGAGCCATAC
CTCCTCTATCTGGCCCTTACACACATGTAAGCAATTATTTGTCTGCCTTAATCATCCCAG
GGCCAAGTGCTATGCAACTAGGGGACAACCTCTACAATTTGAAATCCATTGAAATTATTC
AAACTAGCCAATCCTAAGCTGTTCACCCTGCCCTGCCTCTTCTTTCCCATGGAGGTTAAC
ATATACATCCCTGGCCTTGAGTGAAATGAAATGACCCAGGCCACAAGCGCATGACCAGTG
GGACTGGAGGGTTCCTTGGTGCATTTGTCACCAAGGCCCGAATCTGGCTCTCTTAACAGA
AAGGCAATTGACACCCATGGGCTCACTTAGCAAAACAGCTGCTTCTAATGGGGATTGCAG
ACTTAAAGAAACTGAGATGCAGCCGGGCACAGTGGCTCATGCCTGTAATCCCAACACTTT
GGGAAGCCAAGGCGGGCGGATCACCTGAGGTTGGGAGGTCGAGACCAGCCTGACCAACAT
GGAGAAATCCCATCTCTACTAAAAATATAAAATTAGCCAGGCGTGGCGGCATATGCCTGT
AATCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATGGCATGAACCTGGGAGGTGGAGGTT
GCAGTGAGCTGAGATTGTGCCATTGCACTCCAGCCTGGGCAACAAGAGGGAAACTCCATC
TCAAAAAAGAAACTAAGATTCATGAGCTGTGGACCAGGGAGCAGTGCAGGGAGTAGTAGC
AAACCCTGTAAAAAAAAAAAATCTTAAATCACCCTTTCTTGTGCCCCTTTTAAGGTTGAC
ACAGTGCATTAAGCAGAAGGGTTAAGTAAGTCTCCATAAAACCCAGAGAAGAGAATGTAA
AGCTCCTCTTTGGAGGAGCTAGACTCCTGTCTGGAGTCACAGCTGAACAAATTCCTTACA
GTTTAAGCACATTTGTGATATTTTTGCATATCACATATGATGCATTCAAACTTAACCTTA
GCTTTGACAGTGCATAAAAACCAAGTGTTGGTATTTGACACTGTAAGCAGTAATGGCCCA
GCAGAATAGTATAGACTGCTTTCACCTGAGAACATCTGAAGACTGGCTGACTCTGGTCAT
AATGCCTCCCAGAACCAGATTTCAATGGGTACGGACATTTGAACTGTTACCTACTTAGGC
CATGGAATGTCTCAAGTTACTCAAACTCACCCGCAAAGGCCTTGCGTCACTTGCGTTCCT
CCTGATCTCGAAGGCAGGTGTGCACACTTAGCAGCTGGCTGTTGCTACCAATGGATTCCC
AGTTGTGCTGCCTTTGCCTAACCTCTACATGCTCTCCCAGGCATAACCACAGAAACCTTC
ACTGAGATATTGAAATTAGCATTAACCACCCCACACACCTGTTTTTATTTACTCAGTTTT
GACAAGCCTTTCCGTGTATATTGCTGTGAAAACAATGAGATAGCTGTAGGTATTCTAGGA
CAACTTTCTTCCTCTCAGGTAAGTTGCATAGCATATTTTTTTTTCTTTTTTTTCCTTAGA
AACAGGGTCTCACTCTGTTGCCCAAGCTGGAATGCAGTGGTGCAAGCATGGCTCACTGCA
GCATCGAACACCTGGGCTCAAGAGATCCTCCCACCTCAGTCTCCCCTGTAGCTGGGACTA
CAGGCATGCACCACCATACCTGGCTTCCTTTTTTAAAAAAAATTATTTTTAATAGGGACA
AGGTCTGGCCATGTTGCCCAGGGTGGTCTCAAACTTCTAAGCTCAAGTGATCCTCTCATC
TTGGCATCCCAAAGTGCTAGTATTATAGGTGTGAGCCACCATGCCCGGCCTCATAGCATA
TTTTTCATGTCAGTTGGATCCCGTGGTATCAGGCATGCTCCTATGCCTATGTAGTGACCT
CAGCTGCCATCCTAATTGACAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved