Homo_sapiens Locus Mono:145:AC092324.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:145:AC092324.3
Homo_sapiens
Mono:145:AC092324.3
16
SNORA27L2
1001..1124
2124
GCACACAAATTTTGGTTTCCTTAGCCTTCCTCTTCTGGGATGTAAATGTGGCAGCATCA
GCATGAACTGGTTCTTTTCTTCCCTCTGGTCCAACAGCATCCTCATTCTCTTTCTGAGAG
TAAGGCAAGATGTGAGGTCTGTACAGGATGTGAGGTGTGAATCTCTTTGCCAAGTATGTA
ATCATGTTGTCTTGGTTAATCCTGACTTCAGTTGAAGAACGAGAGGCAATGAGTACTTCC
TGATTTTCCAGAAAAGTAACTCCTCGGACCTGTTCTATTCCTACCGTCCCCAAAAAATTG
ATCACTTGGCGGATGCTTCCGGATGAACTACTCCTCCAACTCTGGGACTTTACATTCTCC
GCTTTTCAATCACTGTTTTGCTAAAATTTCATATAAGCGTTGACTAAGATGTTGAGGTCA
AGATGATTTAAAAGAAAAAAACAGGCTGGTGCAGTGGCTTACCCCTGTAATCCCAGCACT
TTGGGAGGCTAAGGCGGGAGGATCACTTGAGGTCAGGAGTTTGAGACCAGCTGGGCCAGC
ATGGTGAAACCCCATCTCTATTAAAAATACAAAAACTAACTGGGCATAGTAGTGGGCTCC
TGTAGTCCCAGCGACTCAAGAGACTGAGGCATGAAAATCACTTGAACCTGGGAGGTGGGG
GTTGCGGTGACCCAGGATCACCCCACTTGCACTCCAGCCTGGGAGACGGAGTGAGACCCT
GTCTCGAAAAAAAAAAAAAAAAAAAAAAAAGATTCCCCATTGAGACATTGAGACATATGA
AAAACTAACACACAATTTATCTGGGTTACTATCATCTTTGTTAGCACATAAGCTAGGCAG
ATATATAAGATGTATCTCAATTCTACAATTACATCATTGGGGGAAAATCTAAACATTTTT
CATGGCACATAAATTGAAAGTGATTTCAAAATAGTTTTGTCAGGGAAAACATTACTTCTG
GTTTACTTACATATATTTTACTGTGTATTAAAATCTGGTAGAACCCCCTTTTCACTTTGC
CAATTGGACTTATGTCTTTATTGATCATTCAAGTGAGCAAAGGAAATACGCTTTAAAAAC
TCAGGCAAACGGTGTTTGTCTTGTATCCCGTCAGAGGAAACAAATTGAAGTAGGAAAAAA
AAAGCCTGGTAGAAAATTATTAACTCTAAATGTGGAATAATATTGAATTAACTGAGAAAA
TATATATATATAATCAGCTAAAGGAAATATTTTGCTATGAATGATTAATGTTCCTTAGCA
AAGTTAGAGGAATCATAAATCTAAATCTAATACTTTTAAGAATTAATCTCACTTTATCTC
TAATAAGCTTTGTGGTCTGTGCCTTATTATTATGTTTTGTTATTTGTTAGTTATTATTAG
TTATTATTTTGTTACTAGTTGACACATAATAATGATATATATTTATGGGGTATAGTTTGA
TGTTTCAATATATATATGCATTGTGTAAAAATTAAATCAGGGTATTTACCATGTCGATCA
CCTCATACATTTATCATTTCTTTGTGGTGAGTACATTCAAAATTCTCTCTTCTAGCTATT
TCAAAATAAATAATACAATATTGTTGGCCAGGCACAGTGGCTCACACCTGTAATCCCAGC
ACTTTGGGAGGCCAAGCTGGGCAGACCACCCAAGGTCAGGAGTTCGAAACCAGCCTGGCC
AACTGGCAAAATCCCAGCTCTACATTTTTAGTTTCTATTTTTAACAAAACTTAGCTGGAT
GTGGTGGTACGTACCTGTAATCCCAGCTCAGGGAGGCTGAGGCAGGAGAATCACTGGAAC
CCAGGAGACAGAGGTTGCAGTGAGCCAAGATCATGCCACTGCACTCCAGCCTGGGCAACA
GAGTGAGACTCCATCTCAAAAAACAACAACAACAACAACAAAAATATAGTTAAACATAGT
CACCCTATTGTGCAGTAGGATGCAAGAACTTATTCCTCCTATCTAACTGCAACTTCGTAC
CTGTTGACCAATCTCTCCCTATCTCCTCTCCACTAACCTCCGCAGCCTCTGGTAACCACT
ATTCTACTCTCTATTTCTATGAGATCAACTTCTTTAGATTCCACATAGGAGGGGGATTGT
GCGGTATTTGTCTTTCTGTGCCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved