Homo_sapiens Locus Mono:317:AP003063.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:317:AP003063.3
Homo_sapiens
Mono:317:AP003063.3
11
snosnR66
1001..1099
2099
CAGAAAGATGAAAAAGAAGAGTCGATTAAACATAGGAAATAAATTGAAGAAAAAGACAA
AATCATCTTAGAATGAAAACTAAATTACAAGGTGCCCAAGGGAGAATATATTTAACTAAA
AATATAATGAGACACTAATGAAAGCCATGAAACAGTCAAGAAAACAAAAATGATGGAAAG
AAGGTGCTTTAAAAATGTCAGAAAATGATTAATATAGAAGATAGCAAAGATAATTCAATA
TATGTAATTGAAATCTCTGAAGAAGAAAAAATGAATAGAAATAATATTTAAACTTATCAT
TAAAAGAAAACTTTCTCCAGATGAAAGAAGACGTGAATCTACATATTGAAAGAGCCACCA
TGTGCCTGAGAATATTGACTGGAATGCTTAAGTCTGAGACATTAAGCATATATCTTGATC
AAACTTAAAACTTTTTCTCTACTCTTGATATTGGAAGAAAAGATTTGAAGTCAGACTTCT
TAACTTCTGCTAATGATTGAACAGTATTTCTAAGAAATTCAAAAAAAAAGTGTAAGCAAA
GGATTTTATATACAATCAAGCTGTCCTTTAAATATCAAGGCTGGAGGAAAGGTTTTTAGC
ATGCAAGAATGAAGGGAAATCTGTACTCAGAATCCCCTTCTGAAGAATCAACTAGAAATT
AAGCTTCCTCCGGTTAGAAGTGTCTGGAAAACATCAAGGAAAGGATTTAGAGCAAGAACT
AAATACATTAGTTGCTCTAATACTAAAACCAGGTTGGGGCAAGGGTGAGAGGCCATAATA
CAAACGCTAAAAGTTCTTTAAAAGTAGATATAATGCAGGTTTTTATTGAGAAAGTGAAAA
ATAAAGAAAAAAGTAGAATAAATTCATTGACTGTCACATAGACAGGAGAGATGAGTCAAA
GACTACATTTAAACCTGACAACAAAATAGTAGATGCCTAAATATGAGAAAAGGAGACTGC
AGGTACCATAAAAAGTAGAATGTACTAGAACAACCATACACATTCTTAAATGAATGATGA
AATACCAAAAAGAAAAATAAGCAAAGAACAGATAACAGAAAGAAGCACAGCAAATACAAC
ATAATACTGACAGTAAAAATGACAAAAGAACATGACAAAGTTGGCAGAGAACGTTGGTCA
TGCTAATTAACATAAATGTACTTGTCTATTAAAAGAAAGTTGGCTCAAAGATCAAAAGCC
AAAGAAATGGTGAACACAAAAGAAACATCTAAAGTGAATGATTCAAAATGCTAAAAATAA
AGGGATGCACAAGTTATATCAGGCAAATGGAAATAATAGGAAAGAAAGATTATGATTCTA
ACATTAGACAAAGGAAAATTCAAGCCAGTGGCCTGGAAGGGAAAGTGCAGAAATAGCTCA
AATACGTACGGAAGTTTAGTATATTATAAAGCCTGGCATCTCAAATCATTGAGGAACAGA
CAAACTTTTTAACAAATGGCATTAAGACAACTGAAATATCTTTGAGGAGATGATAAAAGT
GGCTTCTTTCTTCATATCATTCAGCAGAATAAACTCCAAATACATTTTTAAAAATGTAAA
AGATGGAATCGTATAGGTACTGGGTGTGAGGAAAGGCTTTCTAACTAGGGTTAAAGATCT
AGCTGCAATGAAAACAAACCAGATTATTTAACTACATTAAAATAAACATTAATACAGCAA
AACAAAACAAAACAATATAAAACAAAAAAACACCATAAGTAAAGTCAAAAGACGGGTGTG
CAGCAGAGCTAGGACTGCTCAAAAACAGATGGAAGCATAATAAAAAAGCCCAAAGCCAGC
ATAAAGGGGCTCTTATTGACCAAATTTGGAATGAAAGGGGCATTAAAATTAATATGAAAA
AGTGATTGCCTTGAATGAGTACAGGGATTAACTAGGAAGGAACTTGGGGAAACTTTTTGT
GGCATTGGAAATGTTCTATATTTTGATAAGGGTGTGAATCCTATGGGTGTATATGCTTAT
CCAAACTCACCTGACAGTATATGTAAGATTGGGGCACTGCGCTGTATGTAAATTATACCT
CAATTCTTAGAAAAATTATAAGAATGGATTAAAACATATTGAACCTTAAAAATCCATGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved