Homo_sapiens Locus Mono:71:AC027237.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:71:AC027237.8
Homo_sapiens
Mono:71:AC027237.8
15
SNORD3@L35
1001..1208
2208
CAGCCATGGACCTGGGTACGCTTCCAGTGGCCACAGATGTGAACACAATGCTGAGAGCA
ATGGAAATGTAAGCAAAGTAACATGTATGCTTGGTGAACAATCAGAAGTATGAAATACGA
GAAACCAAACCTGCCTGATTGATAAGAATGGGGGGCCGGGTGCAGCGGCTCACGCTTGTA
ATCCCAGCACTTTGGGAGGCTGAGGCAGGCGGATCATGAGGTCAGGAGTTCAAGACCAGC
CTGACCAATATGGTGAAACCCTGTCTCTACTGAAAATAAAAAATTAGCCAGGTGTGGTGG
CGCACACCTGTAATCCCAGCTACTTAGGAGGCTGAGGCAGGAAAATTGCTTGGAGGCGGA
GGCTGCAGTGAGCCGAGATCGCGCCACTGCACTCAGGCCTGGGAGACAGAGTGAGACTCT
GTCTCAAAAAAACAAAACAAAAAACAAACAGAAAAAATGGGGGGTAGGGGGTTTGAGGAG
CACAAGGCTTGGACCTACTAGACCTGGAGATTTGGGGAACGAGGGATGCCAGCCATGTTC
CTTGTACTGTATGCAAAAGGGAAGTAACAAGTATTGAATGTTCACTTACCTCTTTCATTC
CCCAATATGAAATAGATATTCCCATTTGCAAAAAAAAAAAAACAAAAAACAAAAAACAAA
AAAAAAGAAGGCTCAGGAGAACTAGAAAGCAGATGAAACAAAGAGGACTTCATTCAGTAC
CAGATGAATTTAGTATTTCTATGTATGTATGTGGGTCTCCTAATTTGATTTTCAAATTGT
TCTTTAGAAAGATTTTTAGCTATATTAAGATTTCTTAAAAAGCTGGGCCATGCCAGGCAG
GGTGGCTCATGCCTACAGTCCCAGCCACTCAGGAGGCTGAGGCGGGAGGATCACTTAGCC
CAAGAAAGGCTGCAGTGAGCTATGACCATGCCACTGCACTCCAGCCTGGGCAACAGTGAG
ACCCTGTCTCAAATAAATTGAAAAAAAAAAAATGCTGGACCAAGAGTATAATTTCAGGCA
TCAATTCTGTAGTTCCTTACTAGAGAAGTTTCTCTTAACATGTACAACACTGGAAACCAT
GAGGAGGTGGCAGCACAGCATTCTCTGCTGAGCGTGAGGTTGGCTCTTGGTGTTGCTTTG
CTGCAACTGTCATTTGCCATTGATGATGGTTCTTCTCTTCCTCCGAGGGAGAGAATGCAG
TCTGAGTGGGGGAAAAAGCCTGGGCCATGGACTTATAGACTGTTAACATTGGAGTCTTGC
TAGTGAACATTTTAGCTATGATTGGATTGTTTGGATAGCTGAGTTTGATATTTACAATAT
CCCTAGCTTACCACTTAATGTCTGCTCTTCTAGATGCTGTCCTTTTCCCGTATCTTGTTA
GTATTCTCTTTAACCCATTTTTCAGCTAAGTGAAGTGTTAGTATTCCCTCCTCTGACACT
TGTTCACTCAGCACAAAGAATTCCTACTGTTACCTCTCCAGAACCCTACGGTCATTATAG
TTGAGGAAGCTGATGCAGGTGGGAGAAAGGACCAGACGCATGGACCATGCTGTTAAGGGA
ACAGGGACAGAGTGGGTTTTAATCTGGTTCACCCATCCACTTACTAGTTTGTAACCTGAG
AGCTTCCACTTCCCCATCCCCAACATGGGGACATACTGTCATGGGACTGTTGTGAAGAAT
GACATGCCACACAGATGAGCAGTCCTAGCTAATGTTAGCTGTTAATGGGTGAAGGAAAAG
CAGGCACTTAACATGTGGATATAGGCTATCCCTTATCTTTGTCTTGTGACACCATCCTCA
CTAGTTCACAATTGCCCTTTCGTACAGGCTAAGCATCCCTTATCCGAAATGCTTGGAACC
ATTTGTGTTTCAGATTTCTACTTTTTTCCAGACTTCGGAATATTTGTATATACTTAAGGT
TTTTATGTATACTTTATGATCTTAGATAATTTTAGACAGGGTCCTGCTCTGTCACCCAGT
CTTGAGTGTAATGATACAAACACGGCTCACTGAAGCCACAGGTACATGCCACCACACTGC
ACTAATTTAAAACAAAATTTCTTGTAGAGGCTGGGATAGGTTTAAGCAATCCTCCTGCCT
CAGCCTCCCAAAGTGCAGGAATCGCAGGCATGAACCACCATGCCTGGCCTATGGTTTTAA
TATACAGGTTGGGCATTCCTTACCTGAAAATCCAAAACGTTCCAATGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved