Homo_sapiens Locus Mono:208:Z95327.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:208:Z95327.1
Homo_sapiens
Mono:208:Z95327.1
X
SNORA9
1001..1133
2133
TTGGTCATGGCAGGCAAGAGAAGAAAGAGGCATTTCAAATACTGTGATATTATCATTTA
GGAAAAAAGCCAAATTTTAATATCTACATCTGACATCTATGGGCCACAAAACTCCAGCTG
GATTGTTTGGATAGCTGTGTTTGTGTACAAAAATAGAAAGCTCTTTGTACAAAATGTAAA
ATATACTGTGTACATACAGAATATTGAAGGTGCAAGAAATGGTGGTCTACAGACAATTTC
TATTTGAGCTCAGGGAACTAATTCAAGTAACTCCTTGAAAACCTGATGTGATTTGCTTTA
TTCATAACCTAATGCCTCCTCCCACCTTCATTTGTTTCATCAGCTCAAACATCTGCTCTG
GTGGAAGGCTGGCAACTGCTTTGCTAATGGACTCAGGGGCATCCTCAGGACTGATGGTCT
CTCCATAAGGTGACTCAATGACAGGGGCACCAGTGCCAAGGCCTAATCAAGAAGAAAGTA
CAAGAAAGTTAGGGAGGCAAAACAAAAAGCTAAATCATTTCAAATATCTACTTTTCAGGG
CTGCTGTAAGAACCAGCTGATAATTTTAGATTCTCCAGAGCTGAGAAATAAATGATGTGA
AAGCCTCTTGTTTCTGTGGAGGAAAGTGAGAGTGTATTTTCTGTTCTCAGAGGAAAGCTG
GGGATCATGATCACATGGAAGGACAATGTTAACCTAAGTTAGAGAACTAGGCACATTGAC
TTCTTTTAACAAGTCATTTCAGAAACAAAAGGTTAAAAGAGAAAAATACGCTAACTTCAA
AAATTCCTGAAAAGAGTGACAGGAATGACTAATGCCACAGTTAGTACTACTAATGGCTTG
ATGAATTTGAATTCATCTTTAACTGGAAATAACTCCTTAGCAATGGAAATTCTTTTTTTT
TTTTTTTTTTTTGAGACAGAGTCTCACTCTGTCGCCCAGGCTGGAGCAACTGAAGAATTT
CTAATGTCAACTTTATCTGTTTCTTAAAGATATACACTTACTAGCAAGCCTCCAGCATGC
TTAGGTCTGCAGTGACCCTATGCATCCCTACAGTGCTTGCCAGAACAGTTTTGAAACGGT
TTGAGGCCTTGCCCTGCTCCATCCAGAGCAAGGGTATAGAAATTTCAGACAATTACTTGA
AAAAAAATTTATAAAAAGTTTTTAAAAAGATATATATAATACTTGCCTAACTCAGGCACA
TCAGGTCAGTCAAGTAATAAACAAGCTGCGTGGCTAACCATTTCAGCATATTCTAAAACA
TATCAGAAATGGAAAATCTTCATTGTTACATCTTTACTAACTCATACTGCATCCAAGTTG
GATTTGTACTCACTCTTCAGCTCTTCTTTGTTCTTTTCACTGGCAGCATTGTCCACTCGA
AGTGCTCTCCCACTGAATTCGCGCCCATTCAGGTTCCGCATGGCACTAAGTGCTGTCTCT
TGGTCTTGGTATTCACAGAAGCCATAACCCTTTGGCTTTCCTGTCTCTCTATCGTATACC
AATCTGGAGAGCAGAACCAAGTGTCAGGAACAAATGTTACACACATACAGGGTTCCTGCT
AACATTGCCATGCTTTAATTGGGCCCACTGTAACATAAATAACCTTATATCTCTGACAGC
CTCACAGAAATATTTTTTAAAACTTTTTTTTTTTTTTTCCTGAGATGGAGTCTTGCTCTG
TTGCCCAGGCTGGAGTGCAGTGGCATGATCTTGGCTCACTGCTATCTCTGCCTCCCGGGT
TCAAGCAATTCTCCTGTCTCAGCCTCCTGAGTAGCTGGGACTACAGGCATGGGCCACCAC
GGCGGCTAATTTTTGTATTTTTAGTAGAGACAAGGTTTCACCACATTGGTCAGGCTGGTC
TCGAACTCCTGACCCCAGGTGATCCGCCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAG
GCTTGAGTCACTATGCCCTGCCTAAAAAACATTTTTAACGAAAAAAACATATTTTAGGTA
AGAATAAATGTCAATTGTATAGTGTATCAATTATATCTCAATAAAGCTGTTACAAGAACA
AAATGTATGTGAAAAGTCACCAGTAAAGAAAACCTGCCATTATTACTAAGAGCCAAATCT
GTGGTGATTTTTAAGAAGCTCCCACCATGAAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved