Homo_sapiens Locus Mono:79:AC024067.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:79:AC024067.4
Homo_sapiens
Mono:79:AC024067.4
Y
SNORA70BL6
1001..1139
2139
ATTTATTGGATTCCTAGAGTCTACTGCTTAGCATGCAATACAGTAAACAACTAAGCTCC
ATGATGACTGAATTGACTGGCATACAACAACCACAAATTGTTCTCTTTGAGCACAAAGGG
CATGTAAGAGCTAACAGATGAGTGTCCCAGGCATGGTTCTGCGTAGTTTGTATGATACTG
TATATGATGTTACTAACTAGGCTGGTCAGTTTGGGTGGTGATAACAGTGTGTTACTGGAG
TTAAAGTTACAGAGTCAATCTCTATATGCTTAGTTAGCACCATATTAAAACAAAACAAAA
TTTTTTCCATGCCACAGACTATTAGTGACCTAGCTATCTTACGGATACATGCTGTTGGTC
ATAATACAGACTGAGAGTGTCCAAAACCCATCATTACAACTGGAATTAAAATAACTGGAA
TCAAAGATCAAAGCTGGTCCACACAGAAGGATGAGCACGAAGTCAAAGGTCCAGTCCTTA
AAACCTATACCACCTAGGTATAATCAGATGTCTTTTTCTAGTGCTGTTTGTAGGAAGTAT
TCAGACTTTATTTTGGTTTTTCTTAGCCTCAGTTCTTAGCCTCTTTTTGTTGTTACTAAA
CAAGTTGGAGGCGAAACAATCTAGTGTAGATTCTGGTTTCCTTCTTTTTATTTTCTGAAA
CAGTTTATGTAAGACAAGTATTATTATACTTGTTCCTTGACAGTTTGATAGAATTCATCC
CCCAAATTACTCTAGGCCTGGTGTTTTTGGCAGGAGGTTGGGGAGGTGGTGGTTAAGTAT
GATTAAATTTCTTTAAAGGTTATGGGACTTCTTTGTTTTGCCATTTCTTCCTAAGTCATT
GTGATATTTTATATTTTCCCAGAAGTGTCCACTTAAACTAAGTTTTCAAGCTTATTGTCA
TAAAGTTGCTCAAAATAATCTTATATTTTAAATATGTTTATCTTAATTTTGTCCCTATTT
CTCTTCCTAATACTATTTGTTTACACCTATAGTTTTTCTCTAGATCAGCTTTTCAAAGGT
TTACTGCATTTTACCCTCCCTGATGGGGCTCAGTGTGCGCAGCTGGAAAAAGTAGATGCC
CTGGTTATGCATGCAGCTCATTTGTTGTACATGTTGCTTTAAGGGACCTTGAAGACTCTT
CCCTCTCCCTATTGTTGCCAAAATAACTGCCTCTGATCTGTTTTTGTTTGCATCCCAGGC
CCCAGACTAGCATGTAAGATGCCTTTGAGAAGTCCTAGAACACTGCAGTCAAGGTGGACG
TTGGAAAATAAAAAGGCTTATTGAATTTTCTATCTTTTCAAAGAATCAGCTCCTGGTATT
AACACTATTTCTACTGCTATTCTGTTTTCTGTTCATTAATTTCTGCTTTTATCTTTATTT
TATTTCATTCCTTCTACTTACTTTGGGCTTACTCTGTTTTCAACTTCTTGAGTTGAAAGA
TTAACTCATTTATTTTCACTTTTTCTAATTTTTTAACCTTAAACATGTATTTAAGGTTAT
AGTTTTCTCTCTTTAGCTACTTTACAAGATCTAATGTGGAGTAATTTCATTGTCGTTCAG
CTCTAAATATTTTGTAATTCTCATTATAATTACCTCCTTACCCATGCAGTATCTACAAGG
AAGTTTATCAGAAGTATTCTTTTCTTCTTCAGCTAACTTTTTGTTGCCATTACAAAAAAA
CTATAACCCCTCCATAATCTCAATTCTGTATCTCCACATCCTATTTTTCCAGCTTATTCT
TTCTACTAGGGTGATCCTGAACTACTGTGCATTGTTCAACCTCATGGAATCTCCACTGAC
TCTCATGCTCTTGATGTCCCTTCACTCTCCTCTTTATCGAGATTACATTCCATGATTTAT
CATTATTATCATCACTCTCCCCTCTCTCCCTTTATAGTGCTTGGCAAAACTACAACCTTG
TTTAAATCCAATTTTCTGCCTACTCCACACCTGCACCTGTGCAACTAAATGTGGCTGGAA
AAAAACATACAACCATGCTCATTGGTCTCAATTTAAATTCATTACTTTGAACCTTTAGTG
GACTCTAATGCACACAAAGATACTTCCCTAGTCCATTTACTTTCCTAGATAAATACTTTA
CCCCTTTCCCTTTTAACTCAAACACCCAACACTTCCTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved