Homo_sapiens Locus Mono:87:AL035555.11
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:87:AL035555.11
Homo_sapiens
Mono:87:AL035555.11
6
SNORA8
1001..1114
2114
CACCAGGAAGCGAGGAATTTCACAGTCTGCAGGGCATGGTTATTCAGAGTTCTAAAGTT
CCCTTGCGTCTCTAACCGAAATACAGCTGGGTCTACATAAGTGTGACGCACCCTTGAATA
CCTAGCCTCTAGTCCGTGGTGGCACATAATTGGTACTCAATTGTTTAAGGAAATTGAACA
AAATCTGTCTGAGCCTCAGTAATATCAATTGCCTCAGTGTGTCCATGTGAGAATTACACC
AGCTAGAAGGTGACAGGTGCTTGGTATTTATAGATTCTTGGCCTCTGCTCATGGGTTCCT
GTCATTATCCCTGATATTTTCCTGGTCCACCCTCAAGAATTAGAGACAAACAAAACCCAA
ACAACATCACAAGTAGCAGAAAGACACCTTCACTTTCACATCGCGGTCCTCTGTCCAGAG
AGTCTTGTACTTCTGAAAGTCCTGCAGGGCCTCATGAGCTGCCTTTCTTAGGGAATTTAC
AGAGGAAGAAAGGAGCAGGACCAACTTAGAAATATCCTTGTGCTCCGCTACCCCCGGGTA
AAAATTCTTCAGCTTCCTCGCAGGAATAGCTTCTTCAAAAGATCCTGAAAACAGATGTTT
TTACACTATAAATAACTTCTATATTCAACTTTAAATATTATCAGTTTTAATATTTGTGAT
TCTTTTTCAAACTGTATTTTCTTAAAGATTCTCCCTCCAAGAAACTAAGAGCTATTTTGA
GTAATTAAGAGCTATTCTCTTGCTATCTTCATGTATTCTCATTAAACTATGGTGTCAGAT
TTTGAGCTCTAGATTTCTTTAATCTAGAAGAACTGTTATTCGGAGAGGATAACTGAAAGA
CACTGATTAAAACACCCCAAAATGTTAAAGTCCTTTAAGAAAAGGTTAAAAGCGTTGAAA
TTTCCACCCTGAGGAATAGCGCAGTGGTTCAAGGAGAGACATTACATTTATTATCCAAAT
GACCCTGGGCCAAGTATTTAGTCTTCGTGGATATACTTGTGAGAATTAAATGAGACAACC
TCTGCTGGGGTGTTTAAAGGTCAGCGCTGTAGATATTCAGCATCTGGCATCTTGGCTTCC
TGCTTGTTAAACCTGGTATTTTTACTGATACAGTATTTGTGTAGTTTTCTTAGACTGTTC
AGTTTGATACAGTCTTCAATAGTCACCAATGCTTTTATTTTTCTAGGGTGTCAAATTGAA
AACTAGGCAGATCCACCTACTCTAAAAATGACCCTAAAATAAACTGGTTGAAGAAATTAG
ATCCCAAAGATTCTTGGTGAAGAATCACTATATGCATATTCAAATAGAGATAAGCCCCTC
CTCACAGTAACCTAAAAGAGAATTTCACCTATAGTTTTAGCTGTTTGACGGCCAGTGGAG
GAATCGGCCTGTGTATCACTATATGTATATTCACTATATGCATATTCAAATAGAGATAAA
AGAATCCAAAATACAAGAATTGTGGCCAGGCTGACAGGAGACATGTGGACTAAGCATCAG
TTCTAATAATGAGGGCTAACTTGAAAATACATCTTTTGAAGATAAATTTTGACTCCAGCT
GGCTGGGCACAGTGGTTCATGCCTAGAATCCCAGCACTTTGGGAAGCCCAGGCGGGGAGA
TCGTTTGAGTCCAAGATTTCGTGACCAGCCTGGGCAACATGGCAAAATCCTATCTCCACA
ATAATACAAAAATTAGCTGAGCATGGTGGCACGTGCCGGTAGTCCCATCTACTTGGAGGC
TGAAAGGGGAGGATTGCTTCAGCCAAGAAGGCAGAGGCTGCAGTAAGCTGAGGTTGCACC
ACCTCACTCCAGCCTGGGCAACAGAGTGGGACCCCATCTCTAAATAAATAAAACCAAGTA
GTGGTAAGTTCTCCAGTTTTGTTCTTTTTCAAAATTTTTTTGGCCATTATAGGTCCTTTG
AATTCCCCTATTCTCTATTCAAATTTTAGGATCATCTTATCAATTTCTTCCGCAAAAAAA
GTCTTCTGGGATTTTGATAGAGATTGTATAAAATCTGTAGATCAATTTGGGAAGAACTGC
CAGTTTAATAATATTAGATCTTCCAACCCATGAGCATGATGTATCTCTTCATAGAATAAC
TTTCAGCAATGTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved