Homo_sapiens Locus SNHG8
snOPY snoRNA Orthological Gene Database
Homo_sapiens SNHG8
Homo_sapiens
SNHG8
4
SNORA24
1434..1564
3063
actaaagtagatagaaaccactactaaatcactactttgtcttaaaatgaaagtataat
agactgtaaggttataattgcttttttaagttaaactttgttttacatttacagaaaatt
tgcaaaaatggagtccccacacccccttcatccaatttcccctaccattaatatcttaca
ataccatggtatatctgtcacaataaagaaatcggtattggcactattacctaaattcca
cactttgttcagattcgctagttttccattaatgtcctttttctgctggagatcccagcc
aggataccacattacatttaatcattatgcatcattttctctggcataatagtttctcag
acttttcttgtttttgagtagtgattaggtaatttgtaaaatgctaaccagcgatctcag
ctcaccataacttccgcctctcgggctcaagagattctcccacctcaacctcccgagtag
ccgggactacaggcgttcaccaccacaccaggctaatttttgtatttttagtagaaacgg
ggtttcgccatgttagccaggctggtctccaactcctaacctcaagtgatccgcccgcct
cggcctcccaaagtgctgggatcacagacgtgagccaccgcgttcggcccctttttctaa
tattgtctaaaataagtatcctaaacaggaaataccaaaaaaatccccctcgctttcgtg
acctacaccggtaagcgtcaggatctttcgctatgcgagaaccttttggctctcgtatgt
gcgcatgcgtctggatccggagccaggtgacccgctcagacgtggaccatgtgcggggga
ggggggaaaggagccgcgaagggggtggtagacggaacaggtggagccgcggcggggcta
ggcggggcggggagtgaaacagcataggctccgcccctcgcggcgcttcccccggaatag
cgtcatcagttctataagagagcgtgtgccgaaggcctcggcctttcacattcgggaagc
gtcgggattaggtgaaagtacgtagttgtctttcgtaagttaaaatgataattgggccga
aacttactgccttacctaaaaggcagcgcagtcaggatattggtaggtcgggggcggctt
tggaaacccttaagtttacaagcatgcgcggacttgagtgctcattaggtcgccgggcgt
ccacgtgcagccctggaccctgaaccccggcgtgcgtgggccgtgggccctcggggaaag
gttccgtgcactcggggactccggtgaagcctgttcagccgtctgtgtcatgtggccatc
ttgagtctactctgtcgctcttgtgccctagcaccccgagaaccgtcagtttgagccaga
tggtgagtaataacctgtagcagtttggttgctggttaattctggattgtgaatctccat
gtatctttgggacctgtcagccgtggcagtctcccttcctagccatggaagagcatatcc
ttgtttattggcaaagctgtcaccatttaattggtatcagattctgacttgcacaagtaa
cattcactgttaaaaacctagagggtgccgggttattgggcaaaatttctaaaccgttgt
tcaatgtttctaggaagctgagctgaacacattacgatggatgatggaaacataaggtac
atttcttttttgatatttctgagttaatctgaaacgccttagcggcaggacgttggaaag
ctaaagttggcccgttttgctggcttttgtagtttgagttaacaaccaactgaattagct
gataagatctcaaaacagtgaggtaagtacacagctcggagttttataatgctttttttc
tcttgcagactatcaagaaatccaagtggtaatgggcgaagtttattcagcatccggcaa
tggacttatcgtagttggggaaacgggtgttccgaataatatcctggaagttatcaggac
acctattttaaatataggcctgaattttgtaaagtaatatttaaggtggtccgtgataat
taaataaaatgcttaattcatgtggctactcattgttccttgactgagtgattaatagac
ggaaaggtagttaatagcataatacctcctatttagtgttacacgctcatgtggaagtag
tgtgagtacagttctaaggtaattgcagcctttgtgaaaaatgtaaaatataaaaattac
caggctacccccaagggagacagcagactctttttaaaccatacaaaaatttaaggcagt
tatacaaggtggaaaattatgtatttatttacacaaatatgcacagaacacttgtatctt
tcaaaagtcacacttaagacatagtaaaagcatgttgtatgaaccatgtattcttaagga
ttgagcaaactgcaggctgcttgctgccttttaggtttgctagtccctgatctacttgaa
acagatgttgcttgccccaacactagtttaattataagggcagcctgtgagaaagtttca
atagacatttttctcacctatattgcacgtttttctgaagcccttgtgcaagtgtgtgtg
ccatgtgtagttctatttacatataaacgctactttaaaagtttatcaaaatcatgagtt
tttacaaaagtttttaatgctcttctgcattatatgcagcattgcaaatctgcaaagtag
taaaactataaagcacctttaggtttgcaccagttattacagaaatggggatttgtgaaa
aggatgtaatttgatgtagaagggcaaagtcctttaatgactggcattcaagaggattac
ttaaaacaatttgtaagttcatgctaacctcttccctatatttatactactgggacctgg
ggaaggatccatgacatggaagtatcttgagtgtgccttttaaatttgagcattactgct
aagaatgttctgtaaaggtgcatagttaagcagctatcccttaactcttggagaaatagc
catagggaaaccaatcatttaggtaggagaaccatggggaaaaaaatcagcattttttct
ggag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1381, 1633..1675, 1868..2063
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved