Homo_sapiens Locus Mono:218:AC092805.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:218:AC092805.2
Homo_sapiens
Mono:218:AC092805.2
1
SNORD3@L17
1001..1214
2214
CCGGATGAATATAAGTTATATGCCTGATACAAGAATGGAAAGGGACTTTTCACCATTAC
CTCCTAGTTTGCTCAACAAATAATCTCTTAATGAATACTTCCATAGAATTTTACAGTCAT
AAAAAATGCTTTTGGGATGCCTGCAATTATCTAAAATAAGAAAATATGGCAACTTGAACT
CATGTATTTATCTGTTTCCTCTTTTACTCTACTAAAATAACAAAAGAGGAATCAGAAACT
ATGAACCCACAAGGAAAAGAGAACAGGAAACGACAAAAACAGGAGAGGGATATCCTTCTA
TCTCACTTTAATATGAACAAGTTATAACTCATTTCACAAAACAGAAAATCCTACGGCCTG
AGACTGCAGCGGGAAAAATCAAGGAAATGTCACTTTATTCATGTCCCCAGAACCCTAGGA
AAGCATCAGCATTCAAGGAAAGTTGGATTGATAGTTCAGCTAAAACTTTGTTAGCCAAGC
CTGTGGGCCAGCAGCATAGGCACTCTTAAAAGTGTGTTAGAAATGCAGAATTTCAGGTCC
CATCCAGACCTACCGAATCAGGCCTACACTTTAACTCCCAAGTGCTCTGTAAACCCCTTA
AAATTTGAAAAGCAGTGATATAAAGAGCAGTTCAAATCCCAGAATTTCTCCCATATTCCA
CGGAGCCATGCAACTGCTCCCTCAACCCTAGATAAGAAGTTTTCTCCTGGATGATGTTGA
ACCGAAGAGGTCCCAGATTCAGGCACGCTGGCATCGCTGAAGACAGGAGTGAAGCAACAA
AGTACAGGTATTCTGCTCGTCTACATAATGAAGAACAAGGCCCACTGTGCCCTTATCCTG
TTCAGCAATCCAAAGTCTAGCAGCAGCCTCCCATTCCCAGGTAGAACATTAGAAATTTTT
CTATGGGGGAAACCTACTAGCCCAAAAGAGAAGACCTACACATACTTGTACACATGCAGA
AGACTGACATGGGGAGAATCCAGATTAAGAGTCACCTCGTCAAGACTATATTTTCAGGGA
TCATTTCTACAGTGCACTACTAGAGAAGTTTCTGTGAACTTGTAGAGCACCGGAAACCAT
GAGCAGGAAGTGCAGCGTTCTCTCCTGAGCATGAAGCCGGCTCTTGGTGTGGCTTCGCTG
CAACTGCCATTGGCCATTGATGATCGTTCTTCTCTTCTCTGGGAGAGTAAGAGAGAGAGG
ACACAGTCTGAGTGGTTCCCATCTGAAAAAAAAAAAAAAAGAGAGAGAGTCGCCTCATCA
CCTTAGCGTCCCTATAGTAAATAGAGAGTAAGGCACACAAGTCTGATTCCAATCAGAGTG
AGGGGTAGTTTTTCGGTTTTTTTAATACAATGTGCATTCTCTCAGATTAGTTTCTAGCTC
AGCACCAATAATAAAAAAGAGAAATACTCCAACCCAAGCTACATGTGCAAAGATGTTCAC
TGAAGCATTGTTTATCATAAAAACTATATTTTTAAAAAAAACCATCCGTTAAAAAAAATC
TGGTTTAAGAAAACTAGGTCTCTGTGAAATGGAATACTATAAAACCATTAAAAAGAATGA
AGTAGATCTATATGTGTTCATATGGCATAATCTCCAGGGTATGCTGAAAAGTGAAAAAAA
TAAGGTACAGAAGGATAAATATGATAGACTAACATTTCTATTTAAAATATGTATGTATGT
AACACATTTCCACCTACATATGTACACAAATATATATGCTTGTACTTGGAAAGAAAATGT
CAAGTACATTTCTGAAAGCTGTTAACAATACCTAAATCTGGAGAAAGGAATTGTGGACTT
GGAATGGGAGAAAGACCTGTGTTTTATTGCATACATCTAATTTTTTTACCATATGCATGT
ATTTTCCCACTTAATAACAAAATACTAAAAGGACAGTTTTTTAAGTAGTGTATTTTTATC
TGAAGCACTAGCTACCATTAGAAATAAAATATTCCCAAATCTGTATCCCTTACCTAAAAT
TATCTCATGATAGTGAGACACATAAAATTAAAACTCAACAAGTCCAAAACTAAGCTTCCA
ATCTCGTTATCTCAACCATGACTGCCACCACCATTAAACATGTTTCAGTTCTTCTGTTTC
CTAGTCTGTCCACCCTTCATCAGGTCTCTTGAGTCAGAAACCTGGAAGTCATAGAAGACT
CCACCTTTTCCCTCACTTCCTACCTCTAATCACCAGACCAAATGCTGTCAATTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved